Información

¿En qué medida la pérdida de neuronas en la sustancia negra afecta el movimiento?


Existe una sustancia conocida como MPTP que es capaz de atravesar la barrera hematoencefálica. Una vez que lo hace, se metaboliza en una toxina llamada MPP +, que luego destruye selectivamente las neuronas dopaminérgicas en la sustancia negra pars compacta del cerebro, causando parkinsonismo. Este efecto del MPTP se descubrió cuando los consumidores de drogas fueron envenenados con él en la década de 1980.

¿Qué efecto tiene esta destrucción de neuronas en el movimiento? ¿Estaban estos pacientes completamente paralizados como resultado, o conservaban alguna capacidad para moverse voluntariamente?


¡Grandes preguntas! Aquí hay algunas respuestas rápidas, pero le daré una pequeña recomendación adicional al final si está interesado:

¿Qué efecto tiene esta destrucción de neuronas en el movimiento?

  • Respuesta: Un gran efecto. El término clave aquí es "Parkinsonismo", lo que significa que los síntomas se parecen a la enfermedad de Parkinson. Esto a menudo implica síntomas motores como caminar arrastrando los pies, temblores, rigidez y bradicinesia (que significa movimiento lento). Si bien por lo general no provocan una parálisis total, estos síntomas pueden ser debilitantes y requieren tratamiento, como L-dopa.

¿Estaban estos pacientes completamente paralizados como resultado, o conservaban alguna capacidad para moverse voluntariamente?

  • Respuesta: En general, estos pacientes aún podían moverse, pero tenían grandes dificultades con los movimientos controlados. Como se indicó anteriormente, el Parkinsonismo / Enfermedad de Parkinson se caracteriza por muchos síntomas motores, pero estos no resultan en una parálisis completa. Más bien, hacen que los movimientos voluntarios sean más difíciles y lentos. Según un artículo titulado "The MPTP Story (doi: 10.3233 / JPD-179006)", parece que al menos un paciente estaba casi (si no totalmente) catatónico y exhibía muy poco movimiento voluntario.

Si quisieras saber por qué este es el caso del parkinsonismo y la enfermedad de Parkinson, le animo a que busque las vías directas e indirectas de los ganglios basales en línea. Es probable que haya una buena conferencia con imágenes útiles sobre cómo funcionan estas vías para facilitar (dirigir) e inhibir (indirectamente) el movimiento por sus efectos sobre el tálamo y la corteza motora. Alternativamente, puede hacerme saber que está interesado a través de una respuesta y haré todo lo posible para explicar esos caminos aquí. ¡Espero que esto ayude!


Dopamina

Para cuando una persona esté sentada frente a un neurólogo y le digan que tiene la enfermedad de Parkinson, habrá perdido la mitad de las células productoras de dopamina en un área del cerebro llamada mesencéfalo.

En esta página explicaremos qué es la dopamina y cómo se relaciona con la enfermedad de Parkinson & # 8217s.

La dopamina es liberada por una célula y se une a otra. Fuente: Truelibido

La dopamina es una sustancia química del cerebro que desempeña un papel en muchas funciones básicas del cerebro, como la coordinación motora, la recompensa y la memoria. Funciona como una molécula de señalización y # 8211 una forma en que las células del cerebro se comunican entre sí. La dopamina se libera de las células cerebrales que producen esta sustancia química (no todas las células cerebrales hacen esto) y se une a las células diana, iniciando el proceso biológico dentro de esas células.

Lo hace a través de cinco receptores diferentes, es decir, la dopamina se libera de una célula y puede unirse a uno de los cinco receptores diferentes en la célula diana (dependiendo de qué receptor esté presente). El receptor es análogo a una cerradura y la dopamina es la clave. Cuando la dopamina se une a un receptor en particular, permitirá que algo suceda en esa célula. Y así es como la información de una neurona de dopamina se transmite o se transmite a otra célula. De ahí la razón, la dopamina se conoce como un neurotransmisor.

Los cinco receptores de dopamina diferentes se pueden agrupar en dos poblaciones, según la acción iniciada por la unión de la dopamina. Los receptores de dopamina 1 y 5 se consideran receptores de tipo D1, mientras que los receptores de dopamina 2, 3 y 4 se consideran receptores de tipo D2. A través de estos diversos receptores, la dopamina influye en muchas actividades diferentes del cerebro, especialmente en la coordinación motora.

Dopamina en la coordinación motora

Cuando planea mover el brazo o la pierna, el proceso necesario para iniciar realmente esa acción comienza en un área del cerebro llamada corteza motora. Atraviesa la parte superior de su cerebro & # 8211 desde justo encima de su sien hasta la parte superior de su cráneo. Y la corteza motora se divide en regiones que controlan partes específicas del cuerpo (por ejemplo, las piernas están controladas por la parte superior de la corteza motora, mientras que la boca y la lengua están controladas por regiones más cercanas a las sienes.

Si bien la idea de iniciar un movimiento comienza en la corteza motora, su capacidad para moverse está controlada en gran medida por la actividad en un grupo específico de regiones del cerebro, conocidas colectivamente como "Ganglios basales‘.

La ubicación de las estructuras de los ganglios basales (azul) en el cerebro humano. Fuente: iKnowledge

Los ganglios basales reciben señales de la corteza motora suprayacente, procesan esa información antes de enviar la señal por la médula espinal a los músculos que van a realizar el movimiento.

Piense en la corteza motora como niños emocionados que quieren hacer algo y en los ganglios basales como figuras parentales que deciden si esta acción es una buena idea.

Y el participante más importante en ese ganglio basal & # 8216regulación & # 8217 del movimiento es una estructura llamada tálamo.

Una exploración cerebral que ilustra la ubicación del tálamo en el cerebro humano. Fuente: Wikipedia

El tálamo es una estructura en el interior del cerebro que actúa como la unidad de control central del cerebro. Todo lo que ingresa al cerebro desde la médula espinal pasa a través del tálamo. Y todo lo que sale del cerebro pasa por el tálamo. Es consciente de casi todo lo que está sucediendo y juega un papel importante en la regulación del movimiento.

Las vías directas / indirectas

El procesamiento del movimiento en los ganglios basales implica un camino directo y un vía indirecta. En términos simples, la vía directa estimula el movimiento, mientras que la vía indirecta hace lo contrario (lo inhibe). Los dos caminos funcionan juntos como una sinfonía cuidadosamente coreografiada.

Las características motoras de la enfermedad de Parkinson (lentitud de movimiento y temblor en reposo) están asociadas con una interrupción en el procesamiento de esas dos vías, lo que da como resultado una señal más fuerte proveniente de la vía indirecta, lo que inhibe / ralentiza el movimiento.

Señales excitadoras (verde) e inhibidoras (rojo) en los ganglios basales, tanto en un cerebro normal como en uno con enfermedad de Parkinson. Fuente: Animal Physiology 3rd Edition

Tanto la vía directa como la indirecta terminan en el tálamo, pero sus efectos sobre el tálamo son muy diferentes. La vía directa deja el tálamo excitado y activo, mientras que la vía indirecta provoca la inhibición del tálamo.

El tálamo recibirá señales de las dos vías y luego decidirá, basándose en esas señales, si enviar un mensaje excitador o inhibitorio a la corteza, diciéndole qué hacer ('excitarse y moverse' o 'no emocionarse y moverse'). no te muevas ', respectivamente).

¿Dónde entra en juego la dopamina?

En la enfermedad de Parkinson, a menudo hablamos de la pérdida de las neuronas de dopamina en el mesencéfalo como una característica fundamental de la enfermedad. Cuando a las personas se les diagnostica la enfermedad de Parkinson, por lo general han perdido aproximadamente del 50 al 60% de las neuronas de dopamina en un área del cerebro llamada sustancia negra.

Las neuronas de dopamina pigmentadas oscuras en la sustancia negra se reducen en el cerebro de la enfermedad de Parkinson (derecha). Fuente: Memorangapp

El mesencéfalo está, como sugiere la etiqueta, en el medio del cerebro, justo encima del tronco encefálico (vea la imagen a continuación). Allí residen las neuronas dopaminérgicas de la sustancia negra.

Ubicación de la sustancia negra en el mesencéfalo. Fuente: Memorylossonline

Las neuronas de dopamina de la sustancia negra generan dopamina y liberan esa sustancia química en diferentes áreas del cerebro. Las regiones primarias de esa liberación son áreas del cerebro llamadas putamen y el Núcleo caudado. Las neuronas de dopamina de la sustancia negra tienen proyecciones largas (o axones) que se extienden a lo largo del cerebro hasta el putamen y el núcleo caudado, de modo que la dopamina puede liberarse allí.

Las proyecciones de las neuronas dopaminérgicas de la sustancia negra. Fuente: MyBrainNotes

En la enfermedad de Parkinson, estas extensiones de "axones" que se proyectan hacia el putamen y el núcleo caudado desaparecen gradualmente a medida que se pierden las neuronas dopaminérgicas de la sustancia negra. Cuando uno mira las secciones del cerebro del putamen después de que los axones han sido etiquetados con una técnica de tinción oscura, esta reducción en los axones es muy evidente con el tiempo, especialmente cuando se compara con un cerebro de control sano.

El putamen en la enfermedad de Parkinson (a lo largo del tiempo). Fuente: Brain

NOTA DEL EDITOR: ME GUSTARÍA AGREGAR QUE LA IMAGEN DE ARRIBA NO REPRESENTA A TODOS CON PARKINSON. LA IMAGEN SE ESTÁ UTILIZANDO AQUÍ PARA PROPORCIONAR UN EJEMPLO DE LA PÉRDIDA DE FIBRA DE DOPAMINA OBSERVADA EN EL PUTAMEN. ESTE PROCESO PUEDE DURAR MÁS EN ALGUNAS PERSONAS QUE EL PERÍODO DE TIEMPO INDICADO.

En circunstancias normales, las neuronas de dopamina liberan dopamina en los ganglios basales que excita la vía directa e inhibe la vía indirecta. Actúa como una especie de lubricante para el movimiento.

Sin embargo, con la pérdida de neuronas dopaminérgicas en la enfermedad de Parkinson, hay una mayor cantidad de actividad en la vía indirecta. Como resultado, el tálamo se mantiene inhibido. Con el tálamo sometido, la corteza motora suprayacente tiene problemas para excitarse y, por lo tanto, el sistema motor no puede funcionar correctamente. Y esta es la razón por la que las personas con la enfermedad de Parkinson tienen problemas para iniciar el movimiento.

A las personas con la enfermedad de Parkinson & # 8217s a menudo se les realizará una prueba con un escáner cerebral llamado DAT-scan cuando se les diagnostique. Los resultados de esta técnica de imagen evalúan la cantidad de dopamina que se libera en el putamen. Da como resultado una imagen horizontal del cerebro que se presenta en una pantalla de computadora con regiones rojas (calientes) que se superponen con la ubicación del putamen en individuos sanos, lo que indica la liberación normal de dopamina. En las personas con la enfermedad de Parkinson, sin embargo, hay una reducción significativa en la liberación de dopamina (debido a que hay menos neuronas de dopamina presentes para generar dopamina), lo que resulta en menos coloración roja en la imagen del cerebro de la pantalla de la computadora. En las personas con la enfermedad de Parkinson en etapa avanzada, hay incluso menos coloración en la imagen de la computadora (vea la imagen a continuación).

Transportador de dopamina (DAT) en cerebros normales (A), Parkinson temprano & # 8217s (B) y Parkinsons & # 8217 (C) en etapa tardía. Fuente: Lancet


¿Qué son los cuerpos de Lewy?

La alfa-sinucleína es una proteína que se encuentra exclusivamente en las neuronas. En la EP, la a-sinucleína se encuentra en globos conocidos como cuerpos de Lewy que se encuentran en las neuronas.

Los cuerpos de Lewy se encuentran en neuronas dopaminérgicas en la sustancia negra pars compacta y probablemente contribuyan a la muerte de estas neuronas. Los cuerpos de Lewy se pueden encontrar en otras áreas del cerebro, como la amígdala, el locus coeruleus y el núcleo del rafe.

Estas áreas del cerebro juegan un papel en la ansiedad y la depresión. Un área del cerebro llamada corteza es responsable de la cognición y la función ejecutiva, es decir, la capacidad de planificar el futuro. Se cree que los cuerpos de Lewy en esta área del cerebro causan demencia.


¿Cuales son los sintomas?

Los síntomas de la EP varían de una persona a otra, al igual que la tasa de progresión. Una persona que padece Parkinson puede experimentar algunos de estos síntomas & quot; seña de identidad & quot más comunes:

  • Bradicinesia - lentitud de movimiento, alteración de la destreza, disminución del parpadeo, babeo, rostro inexpresivo.
  • Temblor en reposo - temblores involuntarios que disminuyen con un movimiento intencionado. Por lo general, comienza en un lado del cuerpo, generalmente la mano.
  • Rigidez - rigidez causada por aumento involuntario del tono muscular.
  • Inestabilidad postural - sensación de desequilibrio. Los pacientes a menudo compensan bajando su centro de gravedad, lo que resulta en una postura encorvada.

Otros síntomas que pueden ocurrir o no:

Congelarse o quedarse atascado en su lugar
Marcha arrastrando los pies o arrastrando un pie
Postura encorvada
Letra pequeña y apretada
Problemas de sueño, insomnio
Apatía, depresión
Volumen de voz reducido o temblor al hablar
Dificultad para tragar
Estreñimiento
Deterioro cognitivo


Síntesis de neuromelanina: mecanismos y significado

En contraste con la distribución generalizada de otros pigmentos cerebrales como la lipofuscina, la neuromelanina está restringida a las regiones cerebrales productoras de catecolaminas y se forma solo en las neuronas. La neuromelanina se hace observable por primera vez en el SNpc humano aproximadamente a los 3 años de edad y se acumula progresivamente con el tiempo dentro de las células en las que se ha producido, ya que las neuronas aparentemente carecen de los mecanismos para degradar o eliminar este pigmento. 25, 26 Como consecuencia, la neuromelanina intracelular se acumula con la edad hasta ocupar la mayor parte del citoplasma neuronal. Aunque el envejecimiento es el principal factor de riesgo para el desarrollo de la EP 27, actualmente se desconoce el sustrato molecular que vincula la EP con el envejecimiento.

Melaninas (de la palabra griega melanos ["Negro"]) son un grupo de biopolímeros complejos pigmentados de color marrón-negro que incluyen eumelanina (el pigmento asociado con el cabello y la piel oscuros), feomelanina (característica del cabello rojo y rubio) y neuromelanina (es decir, melanina cerebral, que se cree que contiene un núcleo de feomelanina y una superficie de eumelanina 28). Las melaninas derivan de una vía biosintética compleja iniciada con la hidroxilación de L-tirosina a L-dihidroxifenilalanina (l-dopa). Después de este paso común, la l-dopa actúa como precursora tanto de las melaninas como de las catecolaminas, actuando a lo largo de vías separadas. Aunque la síntesis de pigmentos de melanina periféricos (p. Ej., En la piel y el cabello) se conoce relativamente bien, el mecanismo que conduce a la neuromelanogénesis sigue siendo un tema de especulación. Tanto la neuromelanina como las melaninas periféricas se producen como productos oxidativos aguas abajo de la l-dopa. De hecho, la síntesis de neuromelanina se considera un mecanismo antioxidante protector para eliminar especies de dopamina oxidadas potencialmente tóxicas, como quinonas y semiquinonas, mediante su conversión en neuromelanina. 29 Sin embargo, aunque se sabe que la melanogénesis periférica que ocurre dentro de células especializadas (es decir, melanocitos) es el resultado de una vía biosintética impulsada enzimáticamente en la que la tirosinasa es la enzima clave que limita la velocidad, 30 se asume ampliamente que la neuromelanina es producida por autooxidación de la dopamina. 31 Sin embargo, varias observaciones se oponen a este último concepto. Por ejemplo, la distribución de neuromelanina no coincide completamente con la de la enzima tirosina hidroxilasa (TH) productora de dopamina, y muchas neuronas dopaminérgicas y noradrenérgicas carecen por completo de neuromelanina. 8, 32-34 Además, la neuromelanina no se observa en la mayoría de las especies animales a pesar de la presencia de dopamina y otras catecolaminas en estos animales. 20 Aunque esto podría estar relacionado con diferencias en la esperanza de vida o en la tasa de síntesis de catecolaminas entre especies, aumentos inducidos experimentalmente de dopamina y / o dopamina oxidada en ratones y ratas, logrados con tratamiento crónico con l-dopa 35, 36 o mejorando genéticamente la actividad de TH. , 37 no son suficientes por sí mismos para producir neuromelanina en estos animales, como podría esperarse si la neuromelanina representa un mero proceso de dopamina autooxidada. En esta línea, vale la pena señalar que el uso inicial de l-dopa de George C. Cotzias en pacientes con EP aparentemente tenía como objetivo restaurar los niveles de neuromelanina, y no de dopamina, ya que pensaba que la EP podría resultar de la pérdida del pigmento de neuromelanina en el SNpc. 38 Este enfoque, sin embargo, no logró restablecer el pigmento faltante en los cerebros de la EP (pero proporcionó en cambio un efecto antiparkinsoniano dramático al reemplazar la dopamina agotada, estableciendo así un nuevo tratamiento revolucionario para la EP, aunque aparentemente por la razón equivocada). 38

La identificación de fases específicas y cambios en la tasa de producción de neuromelanina a lo largo del tiempo en humanos 25, 26 sugiere la regulación de la producción y recambio de neuromelanina, posiblemente a través de procesos enzimáticos, 26 como es el caso de todos los demás pigmentos de melanina. 39 Curiosamente, la expresión de tirosinasa podría no estar restringida a los melanocitos, sino que también podría estar presente, aunque a niveles muy bajos, en el cerebro, incluido el SNpc humano. 40-43 Por ejemplo, la expresión del ácido ribonucleico mensajero de la tirosinasa (ARNm) del cerebro se ha informado en la SN humana mediante la reacción en cadena de la polimerasa con transcripción inversa / reacción en cadena de la polimerasa en tiempo real, aunque a niveles apenas detectables. 41-43 De manera similar, 3 experimentos de microarrays diferentes en tejido cerebral humano (Entrez_id: 7299 Allen Brain Institute Seattle, Washington), tejido cerebral de primates no humanos (Entrez_id: 705792 National Institutes of Health [NIH] Blueprint Non-human Primate [NHP] Atlas) , y tejido prenatal humano en desarrollo (Entrez_id: 7299 BrainSpan Atlas del cerebro humano en desarrollo) detectó la presencia de algunas transcripciones de tirosinasa en el cerebro. De acuerdo con los niveles muy bajos a los que el ARNm de tirosinasa podría expresarse, si es que se expresa, en el cerebro, la proteína real no se ha detectado en el cerebro humano cuando se usa inmunohistoquímica o Western blot. 44, 45 De manera similar, las técnicas de espectrometría de masas no lograron detectar cantidades significativas de enzimas y proteínas típicas involucradas en la melanogénesis, incluida la tirosinasa, en orgánulos aislados que contienen neuromelanina de SN humana. 15, 46, 47 Por el contrario, la actividad enzimática de la tirosinasa se ha descrito en extractos de cerebro de SN humana41, aunque 100.000 veces menor que en los melanocitos. 48 Estos resultados inconsistentes podrían atribuirse potencialmente a los niveles muy bajos a los que la tirosinasa podría expresarse realmente, si es que se expresa, en el cerebro y, por lo tanto, se justifican más experimentos para demostrar o refutar de manera inequívoca la existencia de tirosinasa en el cerebro humano. Aunque actualmente se desconoce si la tirosinasa puede contribuir a la síntesis de neuromelanina, esta posibilidad es teóricamente concebible porque la tirosinasa no solo media la hidroxilación de la tirosina y la oxidación de la l-dopa necesaria para la formación de melaninas periféricas, sino que también es capaz de oxidar el anillo de catecol de la dopamina. , que es un evento esencial requerido para la síntesis de neuromelanina. 49 Además, una rara mutación de pérdida de función en la tirosinasa relacionada con el albinismo se ha asociado recientemente con un mayor riesgo de EP, que se ha atribuido a una posible incapacidad de esta variante de tirosinasa para sintetizar neuromelanina en estos pacientes y la posterior acumulación de especies derivadas de la dopamina potencialmente tóxicas que no pueden desintoxicarse mediante la conversión en neuromelanina. 50 Por otro lado, argumentando en contra del papel potencial de la tirosinasa en la síntesis de neuromelanina, se informó la presencia de neuromelanina en los cerebros de 2 sujetos con albinismo, 51 que generalmente se supone que carecen de actividad de tirosinasa. Sin embargo, ese informe se publicó en la era del diagnóstico de la pregenética y, en ausencia de información específica sobre el tipo genético de albinismo que padecen estos casos, no se puede descartar que la actividad residual de tirosinasa estuviera realmente presente en estos sujetos. 52 De hecho, debido a la superposición clínica entre los subtipos de albinismo oculocutáneo (OCA), el diagnóstico molecular es necesario para establecer el defecto genético específico y, por lo tanto, el subtipo de OCA. Entre los tipos más comunes de albinismo, solo el subtipo OCA1 es causado por mutaciones en el gen de la tirosinasa. 53 A su vez, dentro de los sujetos OCA1, la actividad de tirosinasa está completamente abolida solo en el subtipo OCA1A, mientras que en OCA1B aún permanece algo de actividad enzimática, lo que permite cierta acumulación de pigmento de melanina con el tiempo. 53 En este contexto, al menos uno de los sujetos examinados por Foley y Baxter fue diagnosticado con “albinismo parcial” 51, lo que implica que algo de actividad residual de tirosinasa podría haber estado presente en estos cerebros. Por lo tanto, sigue siendo una pregunta abierta si la tirosinasa u otras enzimas relacionadas pueden contribuir a la síntesis de neuromelanina.


Materiales y métodos

Animales

los Aphakia (Alaska) la cepa utilizada ha sido descrita previamente (Semina et al., 2000 Rieger et al., 2001). Se utilizaron C57Bl / 6-Jico como animales de control (Charles-River).

Cirugía

Los ratones C57Bl / 6-Jico de seis o 7 días de edad se sometieron a cirugía para extirpar los ojos. Los ratones fueron anestesiados con isoflurano (florane®) al 2% y N2O (gas portador) y O2 (75: 65% volumen, respectivamente), y los párpados se trataron con lidocaína como anestésico local. Los animales se mantuvieron a 37 ° C con una estera calefactora. Se abrieron los párpados con unas tijeras y se retiró la membrana que cubría el ojo con un microgancho. El globo ocular se extrajo cortando el nervio y el vaso sanguíneo con un bisturí después de haberlos juntado con un fórceps. Los párpados se pegaron con pegamento tisú (Histoacryl® (Braun)) aplicado con una micropipeta. Los animales se recuperaron de la cirugía y no parecieron verse afectados por el procedimiento.

Hibridación in situ

Los cerebros de animales adultos y embriones E12.5 de tipo salvaje y Alaskase recogieron los ratones y se congelaron inmediatamente en hielo seco. Se cortaron secciones sagitales y coronales (16 μm) en un criostato y se recogieron en portaobjetos SuperFrost Plus (Menzel Gläser). La hibridación in situ con sondas marcadas con digoxigenina (DIG) se realizó esencialmente de acuerdo con Schaeren-Wiemers y Gerfin-Moser (Schaeren-Wiemers y Gerfin-Moser, 1993). Brevemente, las secciones se fijaron en paraformaldehído (PFA) al 4% durante 10 minutos y se acetilaron con anhídrido acético al 0,25% en trietanolamina 0,1 M durante 10 minutos. La hibridación se llevó a cabo a 72 ° C en una solución de hibridación que contenía 50% de formamida desionizada, 5 x SSC, 5 x solución de Denhardt, 250 μg / ml de tRNA de levadura de Baker y 500 μg / ml de ADN de esperma de salmón sonificado. Se llevaron a cabo lavados posteriores a la hibridación en 0,2 x SSC durante 2 horas a 72 ° C. La DIG se detectó con un anticuerpo marcado con fosfatasa alcalina (Roche, Mannheim) usando NBT / BCIP como sustrato. Después de la hibridación in situ con DIG, los portaobjetos se deshidrataron en etanol, se aclararon en xileno y se montaron usando Entellan. La hibridación in situ DIG se realizó con las siguientes sondas: a BalI/EcoFragmento RI (bp 915-1137) de la rata ThADNc (Grima et al., 1985), un EcoRHODE ISLAND/PstI fragmento que contiene pb 1 a 285 de la rata Pitx3 ADNc (Smidt et al., 1997), un Nurr1 cRNA que contiene bp 1022 al extremo 3 'del cDNA de longitud completa (U72354), un En1 fragmento que contiene pb 1-1842 de la secuencia de ADNc de ratón de longitud completa (L12703), un En2fragmento (BglII /XbaI) que contiene pb 1351-2101 de la secuencia de ADNc de ratón (L12705), un Lmx1b fragmento (EcoRI) que contiene la secuencia de ADNc de ratón de longitud completa, un Retirado fragmento que contiene pb 1733-1281 de la secuencia de ADNc de ratón (X67812), un transportador de dopamina (Dat) fragmento (ApaI/PosteriorIII) que contiene pb 762-1127 de la secuencia de ADNc de rata (m80570), una descarboxilasa de L-aminoácido aromático (Aadc) fragmento que contiene pb 22-488 de la región codificante del ADNc de ratón, un transportador de monoamina vesicular 2 (Vmat2) fragmento que contiene pb 290-799 de la región codificante del ADNc de ratón, un Nli fragmento que contiene pb 651-1778 del ADNc de ratón (U69270), un receptor de dopamina 2 (D2r) fragmento que contiene pb 342-1263 de la región codificante del ADNc de ratón, una colecistoquinina (Cck) fragmento que contiene el ADNc completo de la rata (nm_012829), un receptor de neurotensina 1 (Ntr1) fragmento que contiene pb 426-931 de la región codificante del cDNA de ratón, y un fragmento de alfa-sinucleína que contiene pb 20-420 de la región codificante del cDNA de ratón.

Hibridación-inmunohistoquímica combinada in situ

Las secciones se trataron como se describió anteriormente para la hibridación DIG, excepto que después de la terminación de la reacción de fosfatasa alcalina, las secciones se lavaron dos veces durante 5 minutos en TBS. Luego se incubaron en 0.3% H2O2 en TBS durante 30 minutos para reducir la actividad de peroxidasa endógena, se lavó dos veces durante 5 minutos en TBS, se bloqueó con suero de ternero fetal al 4% en TBS durante 30 minutos, se lavó dos veces durante 5 minutos en TBS y se incubó durante la noche a temperatura ambiente con anti Th (Pel-Freez, Arkansas, EE. UU. 1: 1000) en TBST (Tris-HCl 0,5 M a pH 7,4, NaCl al 9%, Triton al 0,5%) o anti Pitx3 (1: 500) (Smidt et al., 2000) en TBST . Al día siguiente, las secciones se lavaron tres veces con TBS durante 5 minutos, se incubaron durante 1 hora con inmunoglobulina anti-conejo de cabra biotinilada en TBST (1: 1000), se lavaron tres veces con TBS durante 5 minutos, se incubaron durante 1 hora con avidina. reactivos de biotina-peroxidasa (kit de élite ABC, Vector Laboratories, 1: 1000) en TBST y se lavaron con TBS tres veces durante 5 minutos. Los portaobjetos se tiñeron con DAB (3,3'-diamino-bencidina) hasta que el fondo se tiñó ligeramente. Los portaobjetos se lavaron dos veces con agua desmineralizada durante 5 minutos, se deshidrataron con etanol y se montaron usando Entellan.

Inmunohistoquímica

Se utilizaron secciones de vibratomo fijadas con PFA (4%) para inmunohistoquímica directa, como se describió anteriormente (Smidt et al., 2000). La inmunohistoquímica con secciones de cera de parafina se realizó como se describió anteriormente para las secciones congeladas (Smidt et al., 2000) con las siguientes modificaciones. Las secciones se desparafinaron mediante xileno y se rehidrataron mediante una serie de etanol. Las secciones se hirvieron en citrato de sodio 0,06 M (pH 6) durante 9 minutos y luego se dejaron enfriar a temperatura ambiente. Se utilizaron los siguientes anticuerpos: anti-Th de conejo policlonal (1: 1000 PelFreez) y un anti-Pitx3 de conejo policlonal (1: 500) (Smidt et al., 2000).

Tinción de Nissl

Secciones coronales de cerebro medio embebidas en parafina (7 μm) obtenidas de adultos de tipo salvaje y Alaska los ratones se montaron en portaobjetos SuperFrost plus (Menzel Gläser). Las secciones se desparafinaron, se enjuagaron en agua, se tiñeron durante 10 minutos en violeta de cresilo al 0,5% y se enjuagaron brevemente en un tampón de acetato, pH 4. Las secciones se diferenciaron luego en etanol al 96% durante 30 segundos, se deshidrataron en etanol al 100% y se aclararon en xileno. y montado con Entellan.

Trazado retrógrado en fluoruro

Se utilizó un aparato de estereotacto `` David Kopf '' con adaptador de ratón (Stoelting, EE. UU.) Para inyecciones en Alaska ratones en las siguientes coordenadas para el cuerpo estriado dorsal: (bregma = 0), 1,1 a anterior, 1,5 lateral. La superficie del cráneo se colocó en la posición vertical 0 y la profundidad de inyección fue de 3 mm. Los animales se anestesiaron con 2,5 μl / g de Hypnorm (Janssen 0,315 mg / ml de citrato de fentanilo, 10 mg / ml de fluanisona, IP), adicionalmente se administró 0,8 μl / g de dormicum (Roche 5 mg / ml de midazolam, IP) 5 minutos después de la administración. Inyección de hipnorm. Durante la operación, se aplicó 'CAF-zalf' (Apharmo) a los ojos de los ratones de tipo salvaje para evitar la sequedad de los ojos. La temperatura corporal se mantuvo a 37 ° C colocando a los ratones sobre esteras calefactoras. El trazador retrógrado Fluorogold (Fluorochrome, EE. UU.) Se administró iontoforéticamente a través de una micropipeta de vidrio (diámetro interno 10-15 μm) llena con Fluorogold al 2% en tampón de cacodilato 0,1 M (pH 7,3). El trazador se aplicó utilizando un instrumento de fuente de corriente de precisión midgard 51413 [polaridad -, 5 μA durante 10 minutos (ajuste de pulso 7 segundos encendido, 7 segundos apagado) lápiz rojo (+) en la oreja de los ratones, lápiz negro (-) en Solución de fluoruro]. Los capilares de vidrio (1,5 mm de diámetro exterior, 0,86 mm de diámetro interno, vidrio de borosilicato, pared estándar con filamento interno, instrumentos electromédicos Clark, Reading, Reino Unido) se prepararon en un extractor de micropipetas (Getra, Munchen, Alemania) con los siguientes ajustes: Calefacción: 7.5-8, Imán: 3. Los animales se sacrificaron 48 horas después de las infusiones, y los cerebros se aislaron y fijaron durante 24 horas en PFA al 4% (fresco) a 4ºC. Se cortaron secciones (50 µm) con un vibratomo (Leica) y se examinaron bajo un microscopio de fluorescencia o se usaron para experimentos inmunohistoquímicos adicionales.

Prueba de escalada

La prueba se realizó como se describe (Costall et al., 1978a Costall et al., 1978b) excepto que la escalada se puntuó cada 5 minutos durante 90 minutos (0 = todas las patas en el suelo, 1 = 2 patas en la jaula, 2 = todas las patas en la jaula). Ninguno de los animales fue inyectado con drogas.

Prueba de campo abierto medio

El campo abierto consistió en un cilindro abierto de plexiglás (diámetro 20 cm, altura 30 cm) colocado sobre una placa de plástico blanco. La actividad locomotora se controló durante 15 minutos utilizando un sistema de observación totalmente automatizado (1,6 fotogramas por segundo, Ethovision, Noldus Information Technology, Países Bajos). Los animales se utilizaron a los 3 meses de edad. El experimento se realizó en condiciones normales de iluminación entre las 10 am y las 3 pm.

Análisis cuantitativo automatizado de la marcha

El andar de tipo salvaje y Alaska Los ratones se analizaron como se describió anteriormente (Hamers et al., 2001).


MATERIALES Y MÉTODOS

Animales

Los experimentos se llevaron a cabo en Pitx3-Ratones deficientes de dos estrategias de reproducción diferentes. Ratones adultos C57Bl / 6-Jico de tipo salvaje (Charles River Laboratories, Francia) y ratones Aphakia (ak), que se han descrito previamente (Semina et al., 2000 Rieger et al., 2001 Smidt et al., 2004a) fueron utilizado en la cría homocigótica. En la reproducción heterocigótica, se cruzaron ratones ak macho con ratones C57BL / 6-Jola hembra para generar híbridos F1 heterocigotos. Los híbridos F1 se entrecruzaron para generar Pitx3 +/+ , Pitx3 +/- y Pitx3 - / - progenie. Los genotipos se determinaron mediante análisis de PCR del ADN de la cola. Los ratones preñados fueron decapitados o sacrificados por CO2 la asfixia y los embriones se recogieron en E13.5, E14.5 o E18.5 (el día en que se detectó el tapón copulador se consideró E0). Los ratones adultos fueron sacrificados por CO2 se recogieron asfixia y cerebros. Los ratones se criaron en nuestro laboratorio en condiciones estándar (21,0 ± 1,0 ° C y 50% de humedad) con acceso ad libitum a alimento estándar (Hope Farms) y agua del grifo, en un ciclo de luz: oscuridad de 12:12 horas. Todos los procedimientos experimentales fueron aprobados por el comité de ética para la experimentación animal de la Universidad de Utrecht, Holanda.

Hibridación in situ

Se recolectaron embriones y cerebros adultos y se congelaron inmediatamente en hielo seco. Se cortaron secciones (16 μm) y se recogieron en portaobjetos SuperFrost Plus (Menzel Gläser). La hibridación in situ (ISH) con sondas de ARNc marcadas con digoxigenina (DIG) y marcadas con [33 P] se realizó como se describió anteriormente (Smidt et al., 2004a Smits et al., 2005). Se realizaron secciones marcadas con [33 P]. deshidratado, secado al aire y expuesto a placas de imagen BAS-MS 2340 (Fuji) durante 3-5 días oa películas Kodak Biomax MR (Kodak) durante 3 semanas. Se escanearon placas autorradiográficas de formación de imágenes BAS-MS 2340 que contenían las señales de hibridación utilizando el sistema de formación de imágenes FLA-5000 (Fuji), y se realizó un análisis cuantitativo utilizando el software AIDA Image Analyzer (Raytest). La expresión génica se analizó tanto en el SNc izquierdo como en el derecho (Pitx3 + / +: norte=8 Pitx3 +/- : norte= 5). Por animal, se analizaron dos secciones adyacentes en el SNc. Para evaluar la significancia estadística, los datos se sometieron a la t-prueba (dos colas). Se utilizaron las siguientes sondas: un fragmento de 1142 pb de la rata Th ADNc (Grima et al., 1985), un Aadc (también conocido como Ddc - Mouse Genome Informatics) fragmento que contiene pb 22-488 de la secuencia codificante del ratón (Smits et al., 2003), un fragmento que contiene pb 290-799 de la región codificante del ratón. Vmat2 (también conocido como Slc18a2 - Genoma informático del genoma del ratón) (Smits et al., 2003), una alfa-sinucleína (a-sinucleína Snca) fragment containing bp 20-420 of the coding region from the mouse cDNA(Smidt et al., 2004a), and an Ahd2 fragment containing bp 568-1392 of the mouse coding sequence.

Inmunohistoquímica

Embryos and adult brains were collected, incubated overnight in 4%paraformaldehyde (PFA) at 4°C, and embedded in paraffin. Sections (7μm) were cut on a microtome, collected on SuperFrost Plus slides (Menzel Gläser), de-paraffinated through xylene, rehydrated through an ethanol series and incubated in 0.3% H2O2 in Tris-buffered saline (TBS) for 30 minutes. Next, sections were boiled in citrate buffer (pH 6) for antigen retrieval, blocked with 4% fetal calf serum in TBS for 30 minutes and incubated overnight with rabbit anti-TH antibody (Pel-Freez,Arkansas, USA 1:1000) in TBS/0.5% Triton at 4°C. The next day, sections were incubated for 1 hour with biotinylated goat anti-rabbit immunoglobulin in TBS (1:1000), followed by incubation with avidin-biotin-peroxidase reagents(ABC elite kit, Vector Laboratories, 1:1000) for 1 hour in TBS. The slides were stained with DAB (3,3′-diamino-benzidine) for a maximum of 10 minutes, until the background was lightly stained. Slides were dehydrated with ethanol and mounted using Entellan. Quantification of neurons was performed using a microscope (Zeiss Axiovert 405M) attached to a camera system(MicroPublisher 5.0 RTV) and imaging software (Openlab 5.0.1, Improvision). The number of TH-immunoreactive (TH-IR) neurons was counted unilaterally in anatomically matched adjacent coronal sections. For each E14.5 embryo, four sections were counted in the caudal and rostral domain of the mdDA system. For each E18.5 embryo, sections containing the SNc were analyzed (27-40 sections)and the average number of TH-IR neurons per section was calculated. Only neurons in which cell nuclei could be recognized were counted. Quantification was performed by an independent observer in a blind design. To evaluate statistical significance, data were subjected to the Student's t-test(two tailed).

For double-immunofluorescence staining, sections were incubated overnight with rabbit anti-Ahd2 (Abcam, diluted 1:100) in combination with sheep anti-TH(Chemicon, diluted 1:500) in PBS/0.5% Triton at 4°C. The next day,sections were incubated with fluorophore-conjugated secondary antibodies in PBS (Alexa-Fluor-488-conjugated goat anti-rabbit and Alexa-Fluor-555-conjugated donkey anti-sheep, diluted 1:400 Molecular Probes)for 1 hour at room temperature and embedded with 90% glycerol.

Nissl staining

TH-IR sections were counterstained for 5 minutes in 0.5% cresyl violet and briefly rinsed in an acetate buffer (pH 4). The sections were then differentiated in 96% ethanol for 60 seconds, dehydrated in 100% ethanol,cleared in xylene and mounted with Entellan. Neuronal number per section in the rostral mdDA area was determined in cresyl violet-stained sections,delineated according to TH-IR area. Quantification (norte=3) was performed by an independent observer in a blind design. To evaluate statistical significance, data were subjected to the Student's t-test(two tailed).

Combined ISH-immunohistochemistry

Adult brains were collected, incubated overnight in 4% PFA at 4°C, and embedded in paraffin. Sections (7 μm) were cut and collected on SuperFrost Plus slides (Menzel Gläser). ISH on paraffin wax sections was performed as described for frozen sections with the following modifications: sections were first deparaffinated through xylene, rehydrated through an ethanol series, boiled in citrate buffer (pH 6), and incubated in 0.2 M HCl for 15 minutes. Sections were further treated as described above for DIG-ISH on frozen sections, except that, after termination of the alkaline phosphatase reaction, sections were immunostained for TH with the avidin-biotin-peroxidase complex (ABC) method, as described above.

RNA isolation, PCR and cloning

RNA from E18 mouse whole brain or MN9D cells was isolated using Trizol(Invitrogen) according the manufacturer's guidelines. A sample of Pitx3 +/GFP FACS-sorted mdDA cells from E16 embryos was isolated via the guanidine thiocyanate method.

Full-length Pitx3 cDNA was amplified from cDNA originating from E18 whole-brain RNA, with the following primers: forward,5′-CCCTGCCTGCGCTCCAGAAC-3′ reversed:5′-CCCTGTTCCTGGCCTTAGTC-3′. Pitx3 was ligated in pGEM-T easy vector (Promega) for sequence analysis, and subsequently cloned into pcDNA3.1(-) vector (Invitrogen) using the Apayo y BstxI restriction sites.

To distinguish between the Ahd2 y Aldh1a7 genes,primers with 100% homology to both genes were designed: forward,5′-GACTGATGAGATGCGCATTG-3′ reversed 5′-GTCTTGAGCTCAGTGTATTC-3′. For in vivo determination, RNA originating from E16 ventral midbrain Pitx3 +/GFP cells was subjected to OneStep reverse transcriptase (RT)-PCR (Qiagen). For in vitro determination, RNA from MN9D cells transfected with Pitx3-pcDNA3.1 was used. The obtained PCR fragments were cloned into pGEM-T easy vectors and eight different clones of each cloning were sequence-analyzed (Baseclear, The Netherlands).

MN9D cell culture and cell transfections

MN9D (MN9D-13N) cells were cultured in Dulbecco's Modified Eagle Medium(DMEM) supplemented with 10% (v/v) hiFCS, 100 units/ml penicillin, 100 units/ml streptomycin and 2 mM L-glutamine in a humidified atmosphere with 5%CO2 a 37 ° C. Cells were grown on 10-cm-diameter dishes coated with poly L-lysine. At 2 hours prior to transfection, culture medium was replaced with medium without antibiotics, and transfection was performed using Lipofectamine 2000 (Invitrogen), according to the manufacturer's guidelines. Cells were transfected with 5 μg of Pitx3-pcDNA3.1 or an equal molar amount of empty pcDNA3.1 vector together with carrier DNA and 1 μg of EGFP-N1 vector (Clontech). At 6 hours after transfection, cells were divided and allowed to grow for an additional 30 hours. Transfection efficiency was determined based on GFP fluorescence using a fluorescent microscope, and plates were matched based on their relative transfection efficiency. For MN9D cells, a typical transfection efficiency with Lipofectamine is approximately 80-90%. Finally, cells were harvested for RNA isolation or used for a chromatin immunoprecipitation assay.

Semi-quantitative RT-PCR

Relative gene expression levels were determined using a OneStep RT-PCR kit(Qiagen). We used 50 ng total RNA per reaction, and for each transcript the linear phase was determined and reactions were stopped during that phase for analysis (for primer sequences, see Table 1). Samples were loaded on 2% agarose gels and, after gel electroforesis, gels were scanned using a FLA-5000 imaging system (Fuji) and relative amounts of DNA were measured with a densitometer. Each analysis was replicated at least three times with independent RNA samples to confirm the obtained results. To determine whether RA regulates the expression of TH, we cultured MN9D cells in the presence of 1 μM all-trans RA for 36 hours as described previously (Castro et al.,2001).

Primer sequences for semi-quantitative RT-PCR analysis

Fragments . Forward primer (5′→3′) . Reversed primer (5′→3′) .
OneStep RT-PCR (Fig. 5)
AADCGAAGAGGCAAGGAGATGGTG AACTTTAGTCCGAGCAGCCA
Ahd2AGGCTGGGCTGACAAGATTC AAGGCCACCTTGTCGACATC
Pitx3CCCTCCGCTTCCAGAACATG GTCCACACCGCGATCTCTTC
SncaACTTTCAAAGGCCAAGGAGG AGGCTTCACGCTCATAGTCTTG
TbpGAGAATAAGAGAGCCACGGAC′ TCACATCACAGCTCCCCAC
THCCCACGTGGAATACACAAAG′ GAGGCATGACGGATGTACTG
Vmat2GCAGTCACACAAGGCTACCA TGAATAGCCCCATCCAAGAG
ChIP-assay (Fig. 6)
Region 1 ACCCTGTTGTATCACGTATG CAGTGTGGACTAAAAGCTAG
Region 2 CAGCCAAGTTCCAGGAGATG GTATCTGATACAACCTGGGC
Region 3 GGAGGCAATCATGTAACTATC′ GGGGACCTCAGTAAAGAATC
Region 4 AGGGAGCATGCAAATGAAAG AGCACCAAACAGATCCATTC
Region 5 CATCTGCTCTAGTCAGTAAG ACAGGCATAGAGAAGGCTTC
Region 6 GAGGTAGCTGCTTAACTTAC CCCAGGTAGTATCTTTCTTAC
Region 7 CTGTCCCCTAAATTGACAA ATAGCCACTCTTCCTATAAC
Region 8 GGAAAGGATGTCATATAGTC GCTCCAGAGGCTACTTCAG
Region 9 CCCTTGGACACACAGTTGTC CAATGGCTCCCTTCTCTAATC
Fragments . Forward primer (5′→3′) . Reversed primer (5′→3′) .
OneStep RT-PCR (Fig. 5)
AADCGAAGAGGCAAGGAGATGGTG AACTTTAGTCCGAGCAGCCA
Ahd2AGGCTGGGCTGACAAGATTC AAGGCCACCTTGTCGACATC
Pitx3CCCTCCGCTTCCAGAACATG GTCCACACCGCGATCTCTTC
SncaACTTTCAAAGGCCAAGGAGG AGGCTTCACGCTCATAGTCTTG
TbpGAGAATAAGAGAGCCACGGAC′ TCACATCACAGCTCCCCAC
THCCCACGTGGAATACACAAAG′ GAGGCATGACGGATGTACTG
Vmat2GCAGTCACACAAGGCTACCA TGAATAGCCCCATCCAAGAG
ChIP-assay (Fig. 6)
Region 1 ACCCTGTTGTATCACGTATG CAGTGTGGACTAAAAGCTAG
Region 2 CAGCCAAGTTCCAGGAGATG GTATCTGATACAACCTGGGC
Region 3 GGAGGCAATCATGTAACTATC′ GGGGACCTCAGTAAAGAATC
Region 4 AGGGAGCATGCAAATGAAAG AGCACCAAACAGATCCATTC
Region 5 CATCTGCTCTAGTCAGTAAG ACAGGCATAGAGAAGGCTTC
Region 6 GAGGTAGCTGCTTAACTTAC CCCAGGTAGTATCTTTCTTAC
Region 7 CTGTCCCCTAAATTGACAA ATAGCCACTCTTCCTATAAC
Region 8 GGAAAGGATGTCATATAGTC GCTCCAGAGGCTACTTCAG
Region 9 CCCTTGGACACACAGTTGTC CAATGGCTCCCTTCTCTAATC

Chromatin immunoprecipitation (ChIP) assay

MN9D cells were transfected with Pitx3-pcDNA3.1 or empty pcDNA3.1 expression vector at 90% confluence. At 6 hours after transfection, cells were divided and allowed to grow for an additional 30 hours. Formaldehyde was added directly to the medium to a final concentration of 1%, and cells were incubated at room temperature for 10 minutes. Glycine was added to a final concentration of 0.125 M, and cells were incubated at room temperature for an additional 5 minutes. Cells were washed twice with PBS, harvested and pelleted by centrifugation. ChIP was performed as described previously(Matthews et al., 2005), with some adjustments. Cells were resuspended in lysis buffer [50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% Na-deoxycholate]containing protease inhibitors (Complete Protease Inhibitor Cocktail Tablets,Roche) and were incubated on ice for 20 minutes. Subsequently, the lysate was put through a 27/3-4 G syringe three times. Chromatin was sonicated using a Soniprep 150 sonicator to obtain DNA of an average length of 400-500 bp. Chromatin was pre-cleared with 60 μl of a 50% slurry of Protein A agarose/Salmon Sperm DNA (Upstate) for 1.5 hours at 4°C. Pre-cleared chromatin was incubated overnight with approximately 1 μg of Pitx3 antibody(Smidt et al., 2000), or with 1 μg of rabbit whole serum immunoglobulins (Sigma) as a negative control. Antibody-DNA complexes were captured by adding 20 μl of a 50% slurry of Protein A agarose/Salmon Sperm DNA for 1 hour at 4°C. Immunoprecipitated complexes were washed for 10 minutes with the following wash buffers: twice with 1.5 ml of buffer 1 [20 mM Tris-HCl (pH 8.0), 150 mM NaCl, 2 mM EDTA, 1%Triton X-100, 0.1% sodium dodecyl sulfate (SDS)], once with 1.5 ml of buffer 2[20 mM Tris-HCl (pH 8.0), 500 mM NaCl, 2 mM EDTA, 1% Triton X-100, 0.1% SDS],once with 1.5 ml of LiCl buffer [20 mM Tris-HCl (pH 8.0), 250 mM LiCl, 1 mM EDTA, 1% NP-40, 1% Na-deoxycholate], and twice with 1.5 ml of TE [10 mM Tris-HCl (pH 8.0), 1 mM EDTA]. For elution of the immunocomplexes, 150 μl of elution buffer (TE, 1% SDS) was added and beads were shaken on a vortex for 30 minutes at 4°C. This was performed twice and samples were pooled. Crosslinks were reversed overnight at 67°C and complexes were precipitated and dissolved in TE. Proteinase K was added and samples were incubated for 2 hours at 45°C. Samples were extracted once with phenol/chloroform (1:1)and twice with chloroform. DNA was precipitated and dissolved in 100 μl of PCR grade MilliQ. For each PCR reaction, 2 μl of this DNA sample was used(for primer sequences, see Table 1).

Retinoic acid treatment of pregnant Pitx3 +/- ratones

Following timed matings of Pitx3 +/- parents, pregnant mice were supplemented with all-trans-RA (Sigma), which will be referred to as RA in this article, twice daily from E10.75 to E13.75. RA was dissolved in corn-oil and mixed with powdered food to a final concentration of 0.25 mg/g food, which was supplied ad libitum as previously described(Niederreither et al., 2002c Mic et al., 2003). RA was dissolved freshly each time and supplemented food was supplied at 12-hour intervals. The control Pitx3 +/- animals were treated according to the same protocol, but were supplemented with corn oil without RA. Embryos were isolated at E14.5 and E18.5, and weight-matched Pitx3 +/+ and Pitx3 -/- littermates were analyzed by immunohistochemistry.


Why do neurons die in Parkinson's disease? Study of hereditary Parkinson&rsquos finds that mitochondria can&rsquot be cleared out when damaged

Current thinking about Parkinson's disease is that it's a disorder of mitochondria, the energy-producing organelles inside cells, causing neurons in the brain's substantia nigra to die or become impaired. A study from Children's Hospital Boston now shows that genetic mutations causing a hereditary form of Parkinson's disease cause mitochondria to run amok inside the cell, leaving the cell without a brake to stop them.

Findings appear in the Nov. 11 issue of Cell.

Mitochondrial movement is often a good thing, especially in neurons, which need to get mitochondria to cells' periphery in order to fuel the axons and dendrites that send and receive signals. Sin embargo, arresting this movement is equally important, says senior investigator Thomas Schwarz, PhD, of Children's F.M. Kirby Neurobiology Center, since it allows mitochondria to be quarantined and destroyed when they go bad.

"Mitochondria, when damaged, produce reactive oxygen species that are highly destructive, and can fuse with healthy mitochondria and contaminate them, too," Schwarz says. "It's the equivalent of an environmental disaster in the cell."

Studying neurons from fruit flies, rats and mice, as well as cultured human cells, Schwarz and colleagues provide the most detailed understanding to date of the effects of the gene mutations, which encode the proteins Parkin and PINK1. They demonstrate how these proteins interact with proteins responsible for mitochondrial movement -- in particular Miro, which literally hitches a molecular motor onto the organelle.

Normally, when mitochondria go bad, PINK1 tags Miro to be destroyed by Parkin and enzymes in the cell, the researchers showed. When Miro is destroyed, the motor detaches from the mitochondrion. The organelle, unable to move, can then be disposed of: The cell literally digests it.

But when either PINK1 or Parkin is mutated, this containment system fails, leaving the damaged mitochondria free to move about the cell, spewing toxic compounds and fusing to otherwise healthy mitochondria and introducing damaged components.

The study's findings are consistent with observed changes in mitochondrial distribution, transport and dynamics in other neurodegenerative diseases such as Huntington's disease, Alzheimer's disease, amyotrophic lateral sclerosis (Lou Gehrig's disease), and Charcot-Marie-Tooth disease, the researchers note.

Although the team studied a rare hereditary form of Parkinson's, the findings may shed light on what's going on in the more common sporadic form of the disease, Schwarz says.

"Whether it's clearing out damaged mitochondria, or preventing mitochondrial damage, the common thread is that there's too much damage in mitochondria in a particular brain region," he says.

While Schwarz sees potential in gene therapy to restore normal PINK1 or Parkin to neurons, he is more interested in the possibility of helping neurons flush out bad mitochondria or make enough new, healthy mitochondria to keep them viable. "We may need to do both," he says.


To what extent does loss of neurons in the substantia nigra affect movement? - biología

Neuroscience Online is an open-access electronic resource for students, faculty, and those interested in neuroscience. The project began in 1999 and the first section, Neurobiología celular y molecular, was released in 2007.

Development continues with new features, such as mobile-friendly functionality, course lecture videos, clinical correlate lecture videos and in 2015, we launched Neuroanatomy Online, an open-access electronic laboratory to complement Neuroscience Online as a resource for the study of neuroanatomy.

Neuroscience Online y Neuroanatomy Online need your support. Donations to our site will support further development of new content, animations, videos and self-test examination questions. We want to continue to provide this valuable resource, free of advertisement, fees and without limitations.

Follow the link to make a donation: Neuroscience Online Giving

Video of Clinical Correlate Lecture on Friedreich's Ataxia

The previous motor system chapters have deconstructed the motor system into its component parts, in an effort to portray how the brain’s “divide and conquer” strategy assigns different motor control tasks to different brain regions. This chapter describes the types of disorders that result from damage or disease to different parts of the motor system. In the process, the different components of the motor system are reviewed to see how they work together to produce the fluid, effortless body movements that we take for granted. An emphasis is placed on trying to explain the causes and symptoms of motor system disorders in terms of the basic principles of neuroanatomy and neuronal function that you learned in the earlier chapters.

6.1 Lower Motor Neuron Syndrome

The first level of the motor system hierarchy is the spinal cord, the location of the alpha motor neurons that constitute the “final common pathway” of all motor commands. Alpha motor neurons directly innervate skeletal muscle, causing the contractions that produce all movements. Reflex circuits and other circuitry within the spinal cord underlie the automatic processing of many of the direct commands to the muscles (the “nuts and bolts” processing), thereby freeing higher-order areas to concentrate on more global, task-related processing.

Motor system dysfunction can result from damage or disease at any level of the motor system hierarchy and side-loops. Differences in the symptoms that result from damage at different levels allow the clinician to localize where in the hierarchy the damage is likely to be. Daño a alpha motor neurons results in a characteristic set of symptoms called the lower motor neuron syndrome (lower motor neurons refer to alpha motor neurons in the spinal cord and brain stem all motor system neurons higher in the hierarchy are referred to as upper motor neurons). This damage usually arises from certain diseases that selectively affect alpha motor neurons (such as polio) or from localized lesions near the spinal cord. Lower motor neuron syndrome is characterized by the following symptoms:

Figure 6.1
Fasciculations and fibrillations. Click on buttons to see demonstration.

6.2 Upper Motor Neuron Syndrome

Damage to any part of the motor system hierarchy above the level of alpha motor neurons (not including the side loops) results in a set of symptoms termed the upper motor neuron syndrome. Some of these symptoms are opposite of those of lower motor neuron disorders. Thus, one of the critical determinations a clinician must make is whether a patient presenting with motor problems has an upper motor neuron disorder or a lower motor neuron disorder.

Upper motor neuron disorders typically arise from such causes as stroke, tumors, and blunt trauma. For example, strokes to the middle cerebral artery, lateral striate artery, or the medial striate artery can cause damage to the lateral surface of cortex or to the internal capsule, where the descending axons of the corticospinal tract collect. The symptoms of upper motor neuron syndrome are:

In addition to the above symptoms, damage to the motor cortex and association cortex can result in impairments in motor planning and strategies and in an inability to perform complex motor tasks. Performance of simple tasks is intact, but patients are unable to perform complex, practiced tasks. This symptom is known as apraxia. For example, patients may be unable to arrange a set of blocks to match an example block-structure in front of them. They can move the blocks individually, but cannot come up with a motor plan to arrange them properly. This disorder is known as constructional apraxia. Other apraxias include dressing apraxia (inability to dress oneself) and verbal apraxia (inability to coordinate mouth movements to produce speech).

A section or crush of the spinal cord will result in paralysis of all parts of the body below the damaged region. Even though such an injury occurs in the spinal cord, it is not considered a lower motor neuron disorder, as the alpha motor neurons themselves are not directly damaged. If the damage occurs at the cervical level, then all four limbs will be paralyzed (quadriplegia). If the damage occurs below the cervical enlargement, then only the legs are paralyzed (paraplegia). Other terms used to describe patterns of paralysis are hemiplegia (paralysis to one side of the body) and monoplegia (paralysis of a single limb).

6.3 Disorders of the Basal Ganglia

los ganglios basales have historically been considered part of the motor system because of the variety of motor deficits that occur when they are damaged. The types of symptoms that result from basal ganglia disorders can be divided into two classes: dyskinesias, which are abnormal, involuntary movements, and akinesias, which are abnormal, involuntary postures. Because the basal ganglia were once considered to form a separate, “extrapyramidal” motor system, these symptoms are called extrapyramidal disorders.

  1. Resting tremors are most often associated with Parkinson’s disease. When the patient is at rest, certain body parts will display a 4-7 Hz tremor. For example, the thumb and forefingers will move back-and-forth against each other in a characteristic tremor called “pill-rolling tremor.” The tremor stops when the body part engages in active movement.
  2. Athetosis is characterized by involuntary, writhing movements, especially of the hands and face.
  3. Chorea , which derives from the Greek word for “dance,” is characterized by continuous, writhing movements of the entire body. It is viewed by some as an extreme form of athetosis. Chorea is most closely identified with Huntington’s disease.
  4. Ballismus is characterized by involuntary, ballistic movements of the extremities.
  5. Tardive dyskinesia can result from the long-term use of antipsychotic drugs that target the dopamine system. It is characterized by involuntary movements of the tongue, face, arms, lips, and other body parts. It is thought to occur as the result of an imbalance between the D1 and D2 receptors, thereby favoring the direct pathway over the indirect pathway.
  1. Rigidity is a resistance to passive movement of the limb. Unlike spasticity, rigidity does not depend on the speed of the passive movement. In some patients, this resistance is so great that it is referred to as lead-pipe rigidity, because moving the patient’s limb feels like bending a lead pipe. In some patients, this rigidity is coupled with tremors and is called cogwheel rigidity, as moving the limb feels to the clinician like the catching and release of gears. As with spasticity, the mechanism is not entirely understood, but may result from continuous firing of alpha motor neurons causing a continual contraction of the muscle.
  2. Dystonia is the involuntary adoption of abnormal postures, as agonist and antagonist muscles both contract and become so rigid that the patient cannot maintain normal posture.
  3. Bradykinesia refers to a slowness, or poverty, of movement.

A number of well-known movement disorders are associated with basal ganglia dysfunction. We shall concentrate on 3 of the most well-understood: Parkinson’s disease, Huntington’s disease, and hemiballismus. To understand how these disorders result in the specific symptoms, it is necessary to review the circuit anatomy of the basal ganglia that was presented in the Basal Ganglia chapter.

Parkinson’s disease results from the death of dopaminergic neurons in the substantia nigra pars compacta. It is characterized by a resting tremor, but the most debilitating symptom is severe bradykinesia or akinesia. In advanced cases, patients have difficulty initiating movements, although involuntary, reflexive movements can be normal. It is as if the loss of the substantia nigra neurons has put a brake on the output of motor cortex, inhibiting voluntary motor commands from descending to the brain stem and spinal cord.

Although the cause of Parkinson’s disease is still not known, much has been learned in the past 15 years from the development of an animal model of Parkinson’s disease. This model was discovered by accident when a number of young patients presented with symptoms remarkably similar to Parkinson’s disease. These patients were drug addicts who had been taking an artificially manufactured drug called MPTP (1-methyl-4-phenyl-1,2,3,6-tetrahydropyradine). This drug destroyed the dopaminergic neurons in the substantia nigra, leading to a Parkinsonian disorder. Laboratory animals injected with MPTP have since become a leading model for understanding the disease and developing treatments.

How does the loss of the dopaminergic neurons cause the poverty of movements associated with Parkinson’s disease (Figure 6.3)? Recall from the Basal Ganglia chapter that the substantia nigra pars compacta projects to both direct pathway and indirect pathways neurons in the striatum. Because there are two different types of dopamine receptors, substantia nigra activity excites the direct pathway and inhibits the indirect pathway. The net effect of the direct pathway is to excite motor cortex, and the net effect of the indirect pathway is to inhibit motor cortex. Thus, the loss of the nigrostriatal dopaminergic pathway upsets the fine balance of excitation and inhibition in the basal ganglia and reduces the excitation of motor cortex. In ways that are not understood, this reduction of thalamic excitation interferes with the ability of the motor cortex to generate commands for voluntary movement, resulting in the poverty of movement of Parkinsonian patients. It is as if all of the motor programs stored in cortex are constantly inhibited by the indirect pathway, with not enough excitation of the direct pathway for the desired motor program to become activated.

Figure 6.3
Parkinson’s disease results from degeneration of the nigrostriatal pathway. Three therapeutic interventions are L-Dopa therapy, pallidotomy, and deep brain stimulation.

There is no cure for Parkinson’s disease, but a number of effective treatments exist. The earliest effective treatment was developed when it was first discovered that Parkinson’s disease was caused by a loss of dopaminergic neurons. Because dopamine itself does not cross the blood-brain barrier, L-Dopa, a chemical precursor to dopamine, was used to replenish the supply of dopamine. Amazingly, flooding the system with L-Dopa resulted in profound improvements in the symptoms of patients. Unfortunately, this improvement is temporary, and typically symptoms return after a number of years. Surgical intervention, such as making lesions to the globus pallidus internal segment (pallidotomy), has shown effectiveness in some patients. In recent years, a new therapy, estimulación cerebral profunda of the subthalamic nucleus, has been gaining in popularity. In this treatment, an electrical stimulator is implanted in the subthalamic nucleus. When the electrical current is turned on to stimulate the nucleus, the patient’s symptoms disappear immediately. It is not known why this procedure works, or what its long-term efficacy is. Because the projection from the subthalamic nucleus is excitatory onto globus pallidus neurons, which inhibit the thalamus, it is paradoxical that such stimulation should increase motor cortex activity. One thought is that the stimulation might actually overload the subthalamic nucleus, thereby inhibiting it and disinhibiting the thalamus.

Huntington’s disease (también conocido como Woody Guthrie Disease) is a genetic disorder that is caused by an abnormally large number of repeats of the nucleotide sequence CAG on chromosome 4. Normal individuals have 9-35 repeats of this sequence mutations that cause larger repeats give rise to Huntington’s disease. It is an autosomal dominant mutation, such that the offspring of a patient with Huntington’s disease has a 50% chance of inheriting the mutation. Individuals with the mutated gene will invariably develop Huntington’s disease, usually near middle age. The affected gene codes for a protein known as huntingtin, the function of which is not known. The effect of the mutated version of the gene, however, is to kill the indirect pathway neurons in the striatum, particularly those of the caudate nucleus.

Huntington’s disease is also known as Huntington’s chorea because it is characterized by a continuous, choreiform movements of the body (especially the limbs and face). In addition, the disease in advanced stages is associated with dementia. There is at present no cure or effective treatment for Huntington’s disease.

Why does the loss of indirect pathway neurons in the striatum cause the dyskinesias of Huntington’s disease (Figure 6.4)? Recall that the net effect of the indirect pathway is to inhibit motor cortex. With the loss of these neurons, the excitatory effect of the direct pathway is no longer kept in check by the inhibition of the indirect pathway. Thus, the motor cortex gets too much excitatory input from the thalamus, disrupting its normal functioning and sending involuntary movement commands to the brain stem and spinal cord. Because inappropriate motor programs are not inhibited normally, the cortex continuously sends involuntary commands for movements and movement sequences to the muscles.

Figure 6.4
Huntington’s disease results from degeneration of the indirect pathways cells of the striatum.

Hemiballismus results from a unilateral lesion to the subthalamic nucleus, usually caused by a stroke. This lesion results in ballismus on the contralateral side of the body, while the ipsilateral side is normal (hence the term hemiballismus). The involuntary, ballistic movements result from the loss of the excitatory subthalamic nucleus projection to the globus pallidus (Figure 6.5). Because the globus pallidus internal segment normally inhibits the thalamus when excited, the loss of the subthalamic component lessens the inhibition of the thalamus, making it more likely to send spurious excitation to the motor cortex. Some surgical operations have been performed to relieve the symptoms of hemiballismus, and new pharmacological treatments are in use to relieve the disorder.

Figure 6.5
Hemiballismus results from unilateral damage to the subthalamic nucleus.

6.4 Disorders of the Cerebellum

Like the basal ganglia, the cerebelo has historically been considered part of the motor system because damage to it produces motor disturbances. Unlike the basal ganglia, damage to the cerebellum does not result in lack of movement or poverty of movement. Instead, cerebellar dysfunction is characterized by a lack of movement coordination. Also unlike basal ganglia (and motor cortex), damage to the cerebellum causes impairments on the ipsilateral side of the body.

Figure 6.6
Dysdiadochokinesia. A normal subject can easily perform rhythmic movements like rapidly pronating and supinating the hands and forearms (click NORMAL). A patient with a cerebellum lesion cannot perform this task

Figure 6.7
Intention tremor. A normal subject can make a directed movement to a target (click NORMAL). A patient with a cerebellum lesion displays an intention tremor, in which the movement starts smoothly toward the target but then oscillates back and forth until the hand slowly contacts the target (click ABNORMAL).

Following a strenuous workout with his neighborhood team, a right-handed, 52-year-old former professional basketball player awoke the next morning with paralysis of the right lower extremity. A neurological exam revealed an exaggerated stretch reflex. There was no disturbance of position sense, pain sensation or tactile discrimination. Where is the problem localized?

A. Anterior (ventral) horn, right side.

B. Cerebellum, right side.

C. Posterior (dorsal) columns of spinal cord, right side.

D. Left motor cortex, lateral (inferior) portion of motor map.

E. Left motor cortex, medial (superior) portion of motor map.

Following a strenuous workout with his neighborhood team, a right-handed, 52-year-old former professional basketball player awoke the next morning with paralysis of the right lower extremity. A neurological exam revealed an exaggerated stretch reflex. There was no disturbance of position sense, pain sensation or tactile discrimination. Where is the problem localized?

A. Anterior (ventral) horn, right side. This answer is INCORRECT.

An exaggerated stretch reflex is an upper motor neuron symptom.

B. Cerebellum, right side.

C. Posterior (dorsal) columns of spinal cord, right side.

D. Left motor cortex, lateral (inferior) portion of motor map.

E. Left motor cortex, medial (superior) portion of motor map.

Following a strenuous workout with his neighborhood team, a right-handed, 52-year-old former professional basketball player awoke the next morning with paralysis of the right lower extremity. A neurological exam revealed an exaggerated stretch reflex. There was no disturbance of position sense, pain sensation or tactile discrimination. Where is the problem localized?

A. Anterior (ventral) horn, right side.

B. Cerebellum, right side. This answer is INCORRECT.

Cerebellar lesions do not produce paralysis.

C. Posterior (dorsal) columns of spinal cord, right side.

D. Left motor cortex, lateral (inferior) portion of motor map.

E. Left motor cortex, medial (superior) portion of motor map.

Following a strenuous workout with his neighborhood team, a right-handed, 52-year-old former professional basketball player awoke the next morning with paralysis of the right lower extremity. A neurological exam revealed an exaggerated stretch reflex. There was no disturbance of position sense, pain sensation or tactile discrimination. Where is the problem localized?

A. Anterior (ventral) horn, right side.

B. Cerebellum, right side.

C. Posterior (dorsal) columns of spinal cord, right side. This answer is INCORRECT.

Lesions of the posterior columns of the spinal cord produce sensory deficits, not paralysis.

D. Left motor cortex, lateral (inferior) portion of motor map.

E. Left motor cortex, medial (superior) portion of motor map.

Following a strenuous workout with his neighborhood team, a right-handed, 52-year-old former professional basketball player awoke the next morning with paralysis of the right lower extremity. A neurological exam revealed an exaggerated stretch reflex. There was no disturbance of position sense, pain sensation or tactile discrimination. Where is the problem localized?

A. Anterior (ventral) horn, right side.

B. Cerebellum, right side.

C. Posterior (dorsal) columns of spinal cord, right side.

D. Left motor cortex, lateral (inferior) portion of motor map. This answer is INCORRECT.

The lateral portion of the motor map controls face muscles.

E. Left motor cortex, medial (superior) portion of motor map.

Following a strenuous workout with his neighborhood team, a right-handed, 52-year-old former professional basketball player awoke the next morning with paralysis of the right lower extremity. A neurological exam revealed an exaggerated stretch reflex. There was no disturbance of position sense, pain sensation or tactile discrimination. Where is the problem localized?

A. Anterior (ventral) horn, right side.

B. Cerebellum, right side.

C. Posterior (dorsal) columns of spinal cord, right side.

D. Left motor cortex, lateral (inferior) portion of motor map.

E. Left motor cortex, medial (superior) portion of motor map. This answer is CORRECT!

Lesions to the medial portion of the motor map produce contralateral paralysis of the lower parts of the body.


Astilbin, Found in Plants, Protects Neurons and Improves Motor Control, Mouse Study Finds

A compound found in various types of plants, called astilbin, can protect neurons by preventing over-activation of glia cells (nerve cells that support neurons), excessive alpha-synuclein production, and oxidative stress, researchers working in a mouse model of Parkinson’s disease report.

Parkinson’s disease is mainly caused by the gradual loss of dopaminergic neurons in the substantia nigra, a region of the brain responsible for movement control.

The disease also seems to be associated with over-production of the protein alpha-synuclein in nerve cells of the brain. When this protein clumps together, it gives rise to small toxic deposits inside brain cells, inflicting damage and eventually killing them.

Parkinson’s characteristic symptoms are related to the resulting loss of dopamine-producing nerve cells, and its therapies typically focus on restoring dopamine signaling in the brain to ease problems with movement and balance.

Astilbin, a flavanonol also found in alcoholic beverages (it’s a constituent of wine grape), is known to possess anti-inflammatory, anti-oxidant, and neuroprotective properties.

For this reason, a team of Chinese researchers tested whether astilbin could protect neurons from damage in mice chemically induced to develop Parkinson’s disease.

Researchers injected animals with MPTP — a neurotoxin that has been shown to trigger Parkinson’s symptoms in mice and non-human primates — once a day for five days. Once the animals showed classic Parkinson’s symptoms of motor impairment, they were treated with either astilbin or a saline solution (as a control group) for another seven days.

Behavioral tests revealed that mice given astilbin showed a remarkable improvement in motor function compared to control animals, with significant differences seen in movement scores on a pole and traction test between treated and untreated diseased mice.

Ask questions and share your knowledge of Parkinson’s Disease in our forums.

Biochemical and molecular analysis also showed that astilbin blocked the drop in dopamine brain levels that’s associated with MPTP treatment, minimized the loss of dopaminergic neurons and the activation of glia cells in the substantia nigra, prevented over-production of alpha-synuclein, and reduced oxidative stress — the cellular damage that occurs as a consequence of high levels of oxidant molecules.

Moreover, researchers reported that astilbin activated PI3K/Akt signaling — a chemical cascade involved in the survival and growth of dopaminergic neurons — in the brain after MPTP administration. This finding suggests, they wrote, “that treatment with AST [astilbin] prevents the loss of dopaminergic neurons in MPTP-induced PD [Parkinson’s disease] mice by inducing the activation of the PI3K/Akt signaling pathway.”

Astilbin “exerts neuroprotective effects” on the diseased mice “by suppressing gliosis [activation of glia cells], α-synuclein overexpression and oxidative stress, suggesting that AST could serve as a therapeutic drug to ameliorate PD,” the researchers concluded.