Información

Secuencias de referencia de ADN ribosómico


Tengo algunos problemas para buscar esta información. Estoy haciendo un estudio relacionado con la susceptibilidad filogenética de los huéspedes a los patógenos (basado en una publicación reciente de Nature), específicamente a la gripe. Esto requiere conocer el referencia Secuencia de ADN ribosómico 18S para pollos, patos salvajes, caballos, cerdos y humanos (entre otros). ¿Existe algún recurso que nos permita descargarlos fácilmente?


Para las aves, puede comenzar buscando 18 años en http://birdgenenames.org/cgnc/

Pero, en general, la base de datos de nucleótidos del NCBI debería proporcionarle toda la información y los números de acceso. Vea esta búsqueda amplia: http://www.ncbi.nlm.nih.gov/nuccore/?term=18S+ribosomal+RNA+gene

Añadiendo especificación de especies y otros parámetros, es posible que encuentre lo que está buscando. Por ejemplo, ver gen de ARN ribosómico 18S de pollo


Puede que esté saltando el arma aquí, pero suponiendo que no hayas buscado NCBI o ensembl, lo haría primero.

Esencialmente, toda la información genómica se mantiene mediante una colaboración entre los NIH de EE. UU., EBI de la UE y Japón. Todas las bases de datos están sincronizadas entre sí y, por lo tanto, los datos deberían (teóricamente) ser los mismos (en la práctica nunca lo es). Te sugiero que elijas un servidor y te ciñas a él.

En mi laboratorio preferimos utilizar NCBI, pero eso difiere de un laboratorio a otro.

Puede buscar NCBI siguiendo el tutorial aquí (http://www.ncbi.nlm.nih.gov/guide/howto/find-published-info-gene-sequence/) o ensembl bu siguiendo el tutorial aquí (http: / /www.ebi.ac.uk/training/online/course/ensembl-browsing-chordate-genomes/how-search-ensembl)

Una búsqueda de muestra de pollo le da esto (http://www.ncbi.nlm.nih.gov/gene/100861561) con tres entradas para ADN genómico y una para ARNm. Elegiría una secuencia completa sobre una secuencia parcial.

Es posible que también desee buscar en su ayuda el significado de los cds (secuencia de codificación; lo encontrará)


Fiabilidad taxonómica de las secuencias de ADN en bases de datos de secuencias públicas: una perspectiva fúngica

Las secuencias de ADN se consideran cada vez más como una de las principales fuentes de información para la identificación de especies en muchos grupos de organismos. Dichos enfoques, conocidos popularmente como códigos de barras, se basan en el supuesto de que las bases de datos de referencia utilizadas para la comparación son lo suficientemente completas y presentan entradas anotadas de manera correcta e informativa.

Metodología / Hallazgos principales

El presente estudio utiliza un gran conjunto de secuencias de ADN de hongos de la base de datos internacional de secuencias de nucleótidos inclusiva para mostrar que el muestreo de taxones de hongos está lejos de ser completo, que alrededor del 20% de las entradas pueden estar incorrectamente identificadas a nivel de especie y que la mayoría de las entradas carecen de anotaciones descriptivas y actualizadas.

Conclusiones

Los problemas con la confiabilidad taxonómica y las anotaciones insuficientes en los repositorios públicos de ADN forman un obstáculo tangible para la identificación de especies basada en secuencias, y es evidente que los mayores desafíos para los códigos de barras biológicos serán de naturaleza taxonómica, más que técnica.

Citación: Nilsson RH, Ryberg M, Kristiansson E, Abarenkov K, Larsson K-H, Kõljalg U (2006) Fiabilidad taxonómica de las secuencias de ADN en bases de datos de secuencias públicas: una perspectiva fúngica. PLoS ONE 1 (1): e59. https://doi.org/10.1371/journal.pone.0000059

Editor académico: Cecile Fairhead, Instituto Pasteur, Francia

Recibió: 16 de octubre de 2006 Aceptado: 26 de octubre de 2006 Publicado: 20 de diciembre de 2006

Derechos de autor: © 2006 Nilsson et al. Este es un artículo de acceso abierto distribuido bajo los términos de la Licencia de Atribución Creative Commons, que permite el uso, distribución y reproducción sin restricciones en cualquier medio, siempre que se acredite el autor y la fuente originales.

Fondos: Este trabajo fue apoyado por las fundaciones de Helge Axe: hijo Johnson, Wilhelm y Martina Lundgren, y Lars Hierta.

Conflicto de intereses: Los autores han declarado que no existen intereses en competencia.


Abstracto

La secuenciación ambiental ha ampliado enormemente nuestro conocimiento de la diversidad y la ecología microeucariotas al revelar linajes previamente desconocidos y su distribución. Sin embargo, el valor de estos datos depende fundamentalmente de la calidad de las bases de datos de referencia utilizadas para asignar una identidad a las secuencias ambientales. Las bases de datos existentes contienen errores y luchan por mantenerse al día con la taxonomía eucariota que cambia rápidamente, la afluencia de diversidad novedosa y los desafíos computacionales relacionados con el ensamblaje de alineaciones y árboles de alta calidad necesarios para una caracterización precisa de la diversidad de linajes. EukRef (eukref.org) es una iniciativa continua impulsada por la comunidad que aborda estos desafíos al reunir a taxónomos con experiencia que abarca el árbol de la vida eucariota y ecologistas microbianos, que utilizan datos de secuencia ambiental para desarrollar bases de datos de referencia confiables en la diversidad de eucariotas microbianos. EukRef organiza y facilita la extracción rigurosa y la anotación de datos de secuencia al proporcionar protocolos, pautas y herramientas. La canalización y las herramientas de EukRef permiten a los usuarios interesados ​​en un grupo particular de eucariotas microbianos recuperar todas las secuencias que pertenecen a ese grupo de la Colaboración Internacional de Base de Datos de Secuencias de Nucleótidos (INSDC) (GenBank, el Archivo Europeo de Nucleótidos [ENA] o el Banco de Datos de ADN de Japón [ DDBJ]), para colocar esas secuencias en un árbol filogenético y para curar información taxonómica y ambiental para el grupo. Proporcionamos pautas para facilitar el proceso y estandarizar las anotaciones taxonómicas. Los resultados finales de este proceso son (1) un árbol de referencia y una alineación, (2) una base de datos de secuencia de referencia, que incluye información taxonómica y ambiental, y (3) una lista de quimeras putativas y otras secuencias de artefactos. Estos productos serán útiles para la comunidad en general a medida que estén disponibles públicamente (en eukref.org) y se compartan con bases de datos de referencia existentes.

Citación: del Campo J, Kolisko M, Boscaro V, Santoferrara LF, Nenarokov S, Massana R, et al. (2018) EukRef: curación filogenética de ARN ribosómico para mejorar la comprensión de la diversidad y distribución eucariotas. PLoS Biol 16 (9): e2005849. https://doi.org/10.1371/journal.pbio.2005849

Publicado: 17 de septiembre de 2018

Derechos de autor: © 2018 del Campo et al. Este es un artículo de acceso abierto distribuido bajo los términos de la Licencia de Atribución Creative Commons, que permite el uso, distribución y reproducción sin restricciones en cualquier medio, siempre que se acredite el autor y la fuente originales.

Fondos: Fundación Gordon y Betty Moore moore.org. Recibido por JdC y LWP. National Science Foundation www.nsf.gov (número de subvención 1545931). Recibido por MB, JdC y LWP. Sociedad Internacional de Protistólogos protistologists.org. Recibido por JdC y LWP. Fundación Tula tula.org. Recibido por JdC, VB, MK y PJK. Comisión Europea de Acciones Marie Skłodowska-Curie https://ec.europa.eu/research/mariecurieactions/ (número de subvención FP7-PEOPLE-2012-IOF -331450 CAARL). Recibido por JdC. Academia Checa de Ciencias, República Checa Beca Purkyne. Recibido por MK. Fondo Europeo de Desarrollo Regional http://ec.europa.eu/regional_policy/en/funding/erdf/ (número de subvención CZ.02.1.01 / 0.0 / 0.0 / 16_019 / 0000759CePaViP). Recibido por MK. National Science Foundation www.nsf.gov (número de subvención OCE1435515). Recibido por LS. Investissements d’Avenir (número de concesión ANR-11-BTBR-0008OCEANOMICS). Recibido por CB y CdV. NSERC-DG http://www.nserc-crsng.gc.ca/. Recibido por LWP. Los patrocinadores no tuvieron ningún papel en el diseño del estudio, la recopilación y el análisis de datos, la decisión de publicar o la preparación del manuscrito.

Conflicto de intereses: Los autores han declarado que no existen intereses en competencia.

Abreviaturas: DDBJ, DNA DataBank of Japan EBI, European Bioinformatics Institute ENA, European Nucleotide Archive EnvO, Environment Ontology HTES, secuenciación ambiental de alto rendimiento INSDC, International Nucleotide Sequence Database Collaboration MAST, Marine stramenopiles MIxS, Información mínima sobre cualquier (x) Secuencia NCBI, Centro Nacional de Información Biotecnológica OTU, unidad taxonómica operativa PR 2, base de datos de referencia ribosómica protista SAR, Stramenopiles, alveolatos y ARNr de Rhizaria SSU, gen de ARN ribosómico de subunidad pequeña ARNr 18S, gen de ARN ribosómico de subunidad pequeña eucariota


Una revisión del uso de ADN ribosómico (ADNr) para diferenciar entre crípticos Anofeles especies

Los complejos de especies crípticas son grupos de especies estrechamente relacionadas que son difíciles o imposibles de distinguir por rasgos morfológicos. Estos complejos se conocen a partir de una amplia variedad de artrópodos y son comunes entre los insectos de importancia médica bien estudiados. Por ejemplo, muchos de los vectores anofelinos de los parásitos de la malaria son miembros de complejos de especies crípticas. Los complejos incluyen típicamente especies de vectores y no vectores, y dos o más especies miembros se encuentran a menudo simpátricamente. Hasta finales de la década de 1950, solo dos de esos Anofeles complejos eran conocidos, los A. gambiae complejo de África y el A. maculipennis complejo de Europa. Hoy, decenas de Anofeles Se reconocen complejos de especies crípticas, y la evidencia acumulada sugiere que es probable que los vectores más importantes de la malaria sean miembros de tales complejos.

Se han desarrollado una variedad de métodos para identificar las especies de especímenes individuales a partir de estos complejos, aunque hasta hace poco solo se usaban ampliamente los basados ​​en aloenzimas específicas de especies e inversiones de cromosomas politenos. Las limitaciones inherentes a estos métodos se han eludido con procedimientos basados ​​en ADN, que son especialmente útiles porque se pueden identificar ambos sexos y todas las etapas del desarrollo, y el ADN se puede recuperar de muestras almacenadas mediante una amplia variedad de métodos simples. Se han desarrollado varias técnicas de identificación basadas en ADN, incluidos ensayos de hibridación basados ​​en secuencias repetidas específicas de especies y fragmentos de PCR de diagnóstico producidos mediante el uso de cebadores de PCR aleatorios o mediante la amplificación de ADN con cebadores basados ​​en secuencias específicas de especies conocidas. En esta revisión discutimos los méritos relativos de los diferentes métodos de identificación de especies crípticas, con énfasis en el uso de ADN ribosómico como diana para ensayos de PCR de diagnóstico de especies.


Secuencias de ADN ribosómico específicas de diversos entornos ambientales se correlacionan con contaminantes experimentales

El análisis filogenético de clones de ADN ribosómico 16S (ADNr) obtenidos por PCR a partir de bacterias no cultivadas que habitan una amplia gama de entornos ha aumentado nuestro conocimiento de la diversidad bacteriana. Un posible problema en la evaluación de la diversidad bacteriana basada en la información de la secuencia es que la PCR es sumamente sensible a la contaminación del ADNr 16S. Esto plantea la posibilidad de que algunas secuencias de ARNr ambientales putativas correspondan de hecho a secuencias contaminantes. Para documentar los posibles contaminantes, clonamos y secuenciamos fragmentos de ADNr 16S amplificados por PCR obtenidos a niveles bajos en ausencia de ADN molde agregado. Secuencias de rDNA 16S estrechamente relacionadas con los géneros Duganella (antes Zoogloea), Acinetobacter, Stenotrophomonas, Escherichia, Leptothrix, y Herbaspirillum se identificaron en bibliotecas de contaminantes y en bibliotecas de clones de diversos hábitats, generalmente de baja biomasa. Las secuencias de ARNr detectadas posiblemente sean contaminantes comunes en los reactivos utilizados para preparar ADN genómico. En consecuencia, su detección en muestras ambientales procesadas puede no reflejar organismos ambientalmente relevantes.

El conocimiento de la diversidad microbiana ha aumentado drásticamente en los últimos años, en parte como resultado de la secuenciación de genes de ARNr a partir de ADN obtenido directamente de microbiota no cultivada, a menudo mediante el uso de cebadores específicos de ARNr y PCR (2, 21). Este enfoque se ha aplicado para evaluar la diversidad microbiana en una variedad de entornos, por ejemplo, tundra ártica (34), subsuelos marinos profundos (27), fuentes termales de Yellowstone (14), turberas (26) e infecciones humanas (9). , 12, 17). Aunque el enfoque ha producido una colección diversa de secuencias y ha ampliado nuestra visión de la diversidad microbiana, el análisis de secuencias de ADN ribosómico 16S (ADNr) microbiano tiene limitaciones para relacionar secuencias específicas de ADNr con organismos en el entorno en estudio y está plagado de posibles artefactos.

Un artefacto potencial en la aplicación de la PCR al análisis comunitario es la posible introducción de ADNr contaminante durante los procedimientos experimentales, particularmente en los pasos que preceden a la PCR. En el curso de la compilación de secuencias de rDNA 16S ambientales, hemos observado algunas secuencias muy similares (& # x0003e99 & # x00025) que se obtienen de muchos entornos física y químicamente distintos. De hecho, los organismos representados por estas secuencias pueden prevalecer en entornos tan diversos. Sin embargo, la dificultad de preparar ADN genómico absolutamente libre de ADN contaminante, junto con la exquisita sensibilidad de la PCR para amplificar trazas de ADN diana, hacen que la contaminación sea un problema grave, particularmente con muestras de baja biomasa (16, 18, 28, 29). Presentamos aquí un estudio de las secuencias de rDNA 16S que se obtuvieron de controles de extracción negativos, es decir, la extracción y purificación de ADN realizadas sin muestra agregada, y la correspondencia de estas secuencias con algunas recuperadas de diversos entornos ambientales.

Examinamos las secuencias de ADNr 16S de 96 clones derivados de un producto de PCR resultante de una extracción de control que no contenía una muestra ambiental. Se han realizado análisis menos extensos con controles negativos procesados ​​de forma independiente. La extracción se llevó a cabo de la misma manera que con muestras auténticas que contienen ADN genómico, utilizando lisozima, proteinasa K, dodecilsulfato de sodio, batido de perlas y tratamiento con fenol como se describe en otra parte (4). Los detalles fueron los siguientes: el tampón A consistía en Tris HCl 200 mM (pH 8,0), NaCl 200 mM y EDTA 20 mM, el batido de perlas (0,5 g de perlas lavadas con ácido) se llevó a cabo durante 2 min a baja velocidad y 0,5 min. a alta velocidad, y los ácidos nucleicos se precipitaron a partir de NaCl 300 mM y 3 volúmenes de etanol al 100%. Todas las soluciones se prepararon con autoclave, se filtraron (filtro de tamaño de poro de 0,2 - & # x003bcm, Sterile Acrodisc Gelman Sciences) ddH2O antes de su uso. Aunque algunas bacterias pequeñas podrían pasar potencialmente a través de los poros del filtro de 0,2 - & # x003bcm, un control negativo en ausencia de cualquier molde, es decir, sin el material de control de extracción negativo, no dio como resultado ningún producto de PCR después de 40 ciclos. Todos los procedimientos de extracción de ADN y manipulaciones se realizaron en una campana de flujo laminar para minimizar la contaminación aérea. La muestra se disolvió en 200 & # x003bcl de agua, y se llevaron a cabo 100 - & # x003bcl PCR con 1 & # x003bcl de plantilla (40 ciclos de touchdown PCR, que consta de 20 ciclos de 1 min a 94 & # x000b0C, 40 s comenzando a 67 & # x000b0C y disminuyendo en 1 & # x000b0C / ciclo, y 1 min a 72 & # x000b0C, y 20 ciclos de 1 min a 94 & # x000b0C, 1 min a 50 & # x000b0C, y 1,5 min más 1 s / ciclo a 72 & # x000b0C). Cinco unidades de Ampli Taq Se añadió oro (Perkin-Elmer) por 100 & # x003 bcl de mezcla de reacción. Se utilizaron cebadores específicos de bacterias para la amplificación (27F, AGAGTTTGATCCTGGCTCAG y 805R, GACTACCAGGGTATCTAATCC). Estos cebadores coinciden con la mayoría de las secuencias en el dominio Bacterias en la región objetivo del cebador. Se precipitaron tres productos de reacción de 100 - & # x003bcl con etanol, y la muestra completa se resolvió mediante electroforesis en gel de agarosa. Incluso con estas precauciones, se obtuvieron productos de PCR del tamaño del ADNr después de rondas prolongadas de ciclos térmicos. Los productos de PCR del tamaño del ADNr se eluyeron del gel y se clonaron, y se analizaron 96 clones mediante polimorfismos de longitud de fragmentos de restricción (RFLP) utilizando las enzimas Mspyo y HinP1I como se detalla por Hugenholtz et al. (14). Se identificaron y secuenciaron veinte tipos diferentes de RFLP. Las secuencias de ADNr 16S (460 a 780 nucleótidos & # x0005bnt & # x0005d) se compararon con secuencias conocidas utilizando el algoritmo de búsqueda BLAST con huecos (1, 5) y se alinearon con parientes cercanos utilizando el editor de alineación GDE (19). Las secuencias de rDNA 16S se colocaron en un árbol filogenético que contenía más de 7.000 secuencias de rDNA bacteriano utilizando el paquete de software ARB (30).

El análisis de los clones del control de extracción negativo reveló una colección diversa de secuencias contaminantes. Hemos visto secuencias similares en otros análisis de ADNr contaminantes. Se han encontrado también secuencias de ADNr 16S esencialmente idénticas a las secuencias de control negativo en varios laboratorios en bibliotecas de clones de una amplia diversidad de entornos, como se resume en la Tabla 1. 1. Las secuencias adicionales del control negativo, no informadas en los análisis ambientales, están relacionadas con los rDNA de los siguientes organismos: Micrococcus luteus (98 & ​​# x00025 identidad a MT2), Pseudomonas aeruginosa (Identidad 99 & # x00025 a MT5), un Afipia sp. (97 & # x00025 identidad a MT8), Variovorax paradoxus (97 & # x00025 identidad a MT11), Gemella haemolysans (Identidad 100 & # x00025 a MT1), Shigella boydii (Identidad 99 & # x00025 a MT19), y Phyllobacterium myrsinacearum (99 & # x00025 identidad a MT17). Algunas secuencias eran & # x0003c95 & # x00025 idénticas a las de organismos conocidos. Una compilación de secuencias obtenidas de bibliotecas de control negativo está disponible en nuestro sitio web en http://crab2.berkeley.edu/pacelab/177.htm. Este sitio se actualizará a medida que se determinen secuencias adicionales a partir de bibliotecas de control negativo. Las presentaciones son bienvenidas.

TABLA 1

Distribución de clones contaminantes con representantes de estudios ambientales & # x02009

Clon (es) del control negativoEntorno y clon & # x0003e98 & # x00025 idéntico al clon de control negativo (referencia)GenBank no.Organismo más estrechamente relacionado& # x00025 Identidad a
MT3Subsuelo de bentonita / arena, Canadá, clon K13 (22) <"type": "entrez-nucleotide", "attrs": <"text": "X91528", "term_id": "987803", "term_text": "X91528" >> X91528estenotrofomona maltofila96.7
Drenaje ácido de mina, clon TRA2-7 (11) <"type": "entrez-nucleotide", "attrs": <"text": "AF047649", "term_id": "2944372", "term_text": "AF047649" >> AF047649
MT6Subsuelo de bentonita / arena, Canadá, clon K9 (22) <"type": "entrez-nucleotide", "attrs": <"text": "X91524", "term_id": "987799", "term_text": "X91524" >> X91524Acinetobacter sp. DSM59099.7
Sedimento marino profundo, clon JAP752 (27) <"type": "entrez-nucleotide", "attrs": <"text": "U09828", "term_id": "495561", "term_text": "U09828" >> U09828
Agua subterránea / subsuelo en & # x000c4sp & # x000f6 hard rock lab, Suecia, clon A24otpmn (23) <"type": "entrez-nucleotide", "attrs": <"text": "X91447", "term_id": "1217616", "term_text": "X91447" >> X91447
Agua subterránea granítica profunda, mina de investigación Stripa, Suecia, clon Grupo III (10) <"type": "entrez-nucleotide", "attrs": <"text": "L20812", "term_id": "999472", "term_text": "L20812" >> L20812
MT9Subsuelo de bentonita / arena, Canadá, clon K16 (22) <"type": "entrez-nucleotide", "attrs": <"text": "X91531", "term_id": "987806", "term_text": "X91531" >> X91531Escherichia coli98.0
Prostatitis, clon 5725 (17)NA b
MT14, CMT35PAgua subterránea / subsuperficial, Gabón, África, clon G4 (24) <"type": "entrez-nucleotide", "attrs": <"text": "X91175", "term_id": "984098", "term_text": "X91175" >> X91175Leptothrix cholodnii96.5
Pulmón de cobayo infectado, clon GPMT16 (31) <"type": "entrez-nucleotide", "attrs": <"text": "AF058793", "term_id": "3075486", "term_text": "AF058793" >> AF058793
Drenaje ácido de mina, clon TRB32 (11) <"type": "entrez-nucleotide", "attrs": <"text": "AF047647", "term_id": "2944370", "term_text": "AF047647" >> AF047647
MT18, CTHB-18Subsuelo de bentonita / arena, Canadá, clon K11 (22) <"type": "entrez-nucleotide", "attrs": <"text": "X91526", "term_id": "987801", "term_text": "X91526" >> X91526Zoogloeoides de Duganella (antes Zoogloea ramigera)99.8
Sedimento marino profundo, clon JAP405 (27) <"type": "entrez-nucleotide", "attrs": <"text": "U09778", "term_id": "495530", "term_text": "U09778" >> U09778
Drenaje ácido de mina, clon AMDke9.1 (11)N / A
Antártico, clon BP-S155 (11)N / A
Subsuelo profundo de arena de basalto, clon BS43 (11)N / A
Aguas termales de Yellowstone, clon OPS122B (14) <"type": "entrez-nucleotide", "attrs": <"text": "AF026984", "term_id": "2746093", "term_text": "AF026984" >> AF026984
Suelo de tundra siberiana, clon S-41 (34) <"type": "entrez-nucleotide", "attrs": <"text": "AF016752", "term_id": "2323510", "term_text": "AF016752" >> AF016752
Absceso dentoalveolar (muestra de pus), clon PUS 10,40 (9) <"type": "entrez-nucleotide", "attrs": <"text": "U34035", "term_id": "1039429", "term_text": "U34035" >> U34035
Acuífero contaminado, clon WFeA1-06 (8) <"type": "entrez-nucleotide", "attrs": <"text": "AF050528", "term_id": "2967704", "term_text": "AF050528" >> AF050528
Agua subterránea / subsuperficial, Gabón, África, clones G22 y G41 (24) <"type": "entrez-nucleotide", "attrs": <"text": "X91274", "term_id": "987022", "term_text": "X91274" >> X91274
Suelo hawaiano, clon HRS-17 (20) <"type": "entrez-nucleotide", "attrs": <"text": "AF016530", "term_id": "2702342", "term_text": "AF016530" >> AF016530
Ambiente reductor de humos, aislado molecular de un producto de PCR (6) <"type": "entrez-nucleotide", "attrs": <"text": "AF019941", "term_id": "2443651", "term_text": "AF019941" >> AF019941
Pulmón de cobaya, clon MTseq15 (31) <"type": "entrez-nucleotide", "attrs": <"text": "AF058388", "term_id": "3065808", "term_text": "AF058388" >> AF058388
Tuberculosis micobacterianacobaya infectada, pulmón, clon GPMT3 (31) <"type": "entrez-nucleotide", "attrs": <"text": "AF058387", "term_id": "3065807", "term_text": "AF058387" >> AF058387
MT22Turbera de pH bajo, clones TM221 y TM252 (26) <"type": "entrez-nucleotide", "attrs": <"text": "X97095", "term_id": "1805658", "term_text": "X97095" >> X97095Herbaspirillum seropedicae98.6
Sedimento de la bahía de Carolina, clones RB-06 y RB-37 (33) <"type": "entrez-nucleotide", "attrs": <"text": "U62830", "term_id": "1498401", "term_text": "U62830" >> U62830

Varios clones contaminantes y numerosos clones ambientales de diversos entornos están estrechamente relacionados con los ADNr del género. Duganella (antes Zoogloea). Dichos organismos (& # x003b2-proteobacteria) suelen contaminar las fuentes de agua y se aíslan habitualmente de los entornos de aguas residuales (13) y las biopelículas del agua potable (15). Su aparición en materiales utilizados para experimentos de laboratorio no es, por tanto, sorprendente. Figura & # x200B La Figura 1 1 muestra las relaciones de algunas de las secuencias de contaminantes y grupos ambientales de secuencias con las de Zoogloeoides de Duganella y Herbaspirillum seropedicae. los Duganella grupo de parentesco, visto como dos clados con ca. La identidad 98.5 & # x00025 en secuencias de rRNA, consiste principalmente en secuencias de rDNA ambientales, todas casi idénticas, de varios estudios publicados (6, 8, 9, 20, 22 & # x0201324, 27, 34). Además de Duganella grupo de secuencias, una serie de otras secuencias contaminantes prevalentes, enumeradas en la Tabla & # x200B Tabla 1, 1, se corresponden estrechamente con las secuencias informadas de diversos entornos. Leptothrix spp., por ejemplo, como Duganella spp., se encuentran en agua dulce que fluye lentamente y en agua contaminada y lodos activados. Es notable que se obtengan secuencias de ARNr esencialmente idénticas de ambientes tan diferentes como aguas subterráneas profundas, un sedimento marino, una fuente termal de Yellowstone, un pulmón de cobaya y un absceso dentoalveolar (pus alrededor de los dientes). Es probable que todas las extracciones de muestras ambientales que dieron como resultado clones equivalentes a los ADNr contaminantes hayan contenido solo niveles muy bajos de biomasa. La extracción de ADN de muestras de biomasa baja es particularmente sensible al ADN potencialmente contaminante durante el procesamiento porque el ADN contaminante se diluye mínimamente por el ADN de la muestra. No se determinaron las fuentes exactas de contaminación, sin embargo, el Taq la polimerasa y el tampón de amplificación no están contaminados de forma detectable, ya que las reacciones sin molde añadido o material de control de extracción negativo no produjeron productos amplificados. Por lo tanto, las fuentes más probables de contaminación son sales y tampones, lisozima, proteinasa K y / o perlas de zirconia / sílice.

Dendrograma de distancia evolutiva que muestra las posiciones relativas del clon de rDNA 16S ambiental y las secuencias de cepas para los géneros Duganella y Herbaspirillum. La barra indica la tasa de sustitución de nucleótidos. La longitud de la secuencia en nucleótidos sigue la designación del clon o cepa. Las referencias para los clones se dan en la Tabla & # x200B Tabla 1. 1. Los clones están en negrita; las cepas cultivadas, el aislado marino BAL15 (25), el aislado ártico arc21 (3) y la cepa Mena 23 / 3-3c (32) se muestran en color claro. Las secuencias para las especies bacterianas descritas (cursiva) se obtuvieron de GenBank (5). La secuencia de ADNr de Rhodocyclus purpureus se utilizó como un grupo externo. La resolución del árbol que se muestra aquí está limitada por la calidad de los datos de la secuencia y las longitudes cortas (menos de 500 nt) de muchas secuencias. Se insertaron secuencias cortas (& # x0003c500 nt) en el árbol utilizando la herramienta de inserción de parsimonia del programa de software ARB (30). El clon contaminante CTHB-18 se identificó en una extracción de control negativo separada independientemente de la de la biblioteca de clones MT.

En este estudio, informamos que muchas secuencias de ARNr de subunidades pequeñas obtenidas de bibliotecas de clones de control sin muestras están estrechamente relacionadas con secuencias recuperadas en otros estudios de diversas muestras ambientales. Esta correspondencia de secuencias ambientales y contaminantes puede indicar que algunas de las secuencias ambientales se derivan como contaminantes experimentales y no tienen relevancia para las comunidades ambientales. Dado que es probable que cualquier fuente de secuencias de contaminantes sea idiosincrásica, dependa del operador, la fuente de reactivos, el agua, etc., los investigadores que examinan la biodiversidad utilizando técnicas de clonación ambiental deben ser conscientes de este problema y hacer todo lo posible para minimizar, detectar y analizar contaminación potencial. Quizás el mensaje más importante de los resultados presentados aquí es que la prueba definitiva de la aparición de un organismo indicado por una secuencia de ARNr clonado requiere la identificación explícita de ese organismo in situ. Actualmente, esto se logra más fácilmente mediante el uso de técnicas de hibridación por fluorescencia basadas en ARNr 16S (2, 7).

Números de acceso a la secuencia de nucleótidos.


Materiales vegetales

Treinta y siete especies del Paphiopedilum En este estudio se analizaron los géneros que cubren las siete secciones. La información sobre las especies y las secciones se proporciona en la Tabla 1. Se utilizaron raíces en crecimiento activo para la preparación de cromosomas, mientras que se utilizaron hojas para la extracción de ADN genómico.

Preparación de cromosomas

Las puntas de las raíces se pretrataron con 8-hidroxiquinolina 0,004 M durante 4-6 ha 10 ° C y se fijaron en un fijador recién preparado (etanol: ácido acético 3: 1) durante 48 ha 10 ° C. Las puntas de las raíces fijadas se enjuagaron a fondo con agua del grifo y se maceraron en una mezcla de enzimas que contenía un 2% de celulasa (Onozuka R-10, Rpi) y un 1% de pectoliasa (Aspergillus japonicus Y-23, MP) a 37 ° C durante 30 min. Después de volver a fijar en fijador durante 15 min, las células meristemáticas se aplastaron en una gota de ácido acético al 45% bajo un cubreobjetos (22 x 22 mm) en un portaobjetos de microscopio. A continuación, los portaobjetos se sumergieron en nitrógeno líquido y se secaron al aire después de retirar cuidadosamente los cubreobjetos con una cuchilla.

Etiquetado de sondas e hibridación in situ de fluorescencia (FISH)

ADNr 25S, 2,3 kb ClaI subclones de la región codificante de ADNr 25S de Arabidopsis thaliana [54] y 5S rDNA (pTa794) [55] se utilizaron como sondas. El ADNr de 25S se marcó con biotina-16-dUTP (Roche) y el ADNr de 5S se marcó con digoxigenina-11-dUTP (Roche), todo mediante el método de traducción de muescas utilizando el kit de Roche. El tampón de hibridación constaba de formamida desionizada al 50%, SSC 2x, fosfato de sodio 50 mM (pH 7,0), sulfato de dextrano al 10% y ADN de esperma de salmón cortado (Invitrogen) en un exceso de 100x de sondas marcadas. Las sondas de ADNr 25S y 5S se mezclaron hasta una concentración final de aproximadamente 2 ng / μl y luego se desnaturalizaron a 94 ° C durante 10 min antes de usarse. Los portaobjetos con extensiones en metafase se trataron con formamida desionizada al 70% en 2 x SSC a 70 ° C durante 2 min. A continuación, se aplicaron sondas desnaturalizadas en tampón de hibridación a los portaobjetos, que se incubaron a 37 ° C durante 10 h en una cámara húmeda. Los lavados posteriores a la hibridación y la inmunodetección se llevaron a cabo en un instrumento de hibridación in situ automatizado, el InsituPro VSi (Intavis Bionanalytical Instruments). Los portaobjetos se lavaron en 2 x SSC a temperatura ambiente durante 5 min y dos veces en 2 x SSC a 50 ° C durante 10 min. La señal de fluorescencia se detectó usando conjugado anti-digoxigenina-rodamina (Roche) y conjugado estreptavidina-fluoresceína (Invitrogen). Las preparaciones se montaron y se contratiñeron en Vectashield que contenía 1,5 µg / ml de DAPI (4 ', 6-diamidino-2-fenilindol) (Vector Laboratories). Las imágenes fueron tomadas por una cámara CCD en blanco y negro Zeiss AxioCam MRm en un Zeiss Imager. Microscopio de fluorescencia Z1 y luego procesado uniformemente usando el software Zeiss AxioVision. Las señales de FISH fueron de color falso y la fluorescencia de DAPI se dejó en tono gris.

Amplificación, clonación y secuenciación por PCR

El ADN genómico total se extrajo de hojas frescas utilizando el kit Qiagen DNeasy Plant Mini. La región 5S-NTS se amplificó mediante PCR utilizando los cebadores degenerados universales: 5'-TGGGAAGTCCTYGTGTTGCA-3 'y 5'-KTMGYGCTGGTATGATCGCA-3' [56]. La amplificación de contacto se realizó de la siguiente manera: un paso inicial a 94 ° C durante 5 min, seguido de 10 ciclos de 94 ° C durante 1 min, hibridación durante 1 min (comience a 60 ° C y disminuyó 1 ° C por ciclo) y 72 ° C durante 1 min, luego 35 ciclos de 94 ° C durante 1 min, 50 ° C durante 1 min y 72 ° C durante 1 min, el paso final a 72 ° C se extendió a 10 min. Después de la purificación en gel utilizando el kit de extracción de gel QIAquick (Qiagen), los productos de PCR se ligaron en el vector pDrive Cloning y se transformaron en células competentes QIAGEN EZ (kit de clonación de PCR Qiagen). Los clones recombinantes se seleccionaron mediante el método de PCR directa de colonias y se secuenciaron 7-8 clones por cada especie usando el cebador T7 (5'-TAATACGACTCACTATAGGG-3 ').

Análisis de los datos

Las secuencias se alinearon utilizando el servidor web MAFFT (Multiple Alignment using Fast Fourier Transform) del Instituto Europeo de Bioinformática [57]. Se utilizaron los parámetros predeterminados: penalización de apertura de brecha = 1.53, penalización de extensión de brecha = 0.123, número de reconstrucción de árbol = 1, maxiterate = 0 y realizar FFTS = par local. La alineación de secuencia está disponible como un archivo FASTA complementario (archivo adicional 4).

Se estimó el polimorfismo 5S-NTS dentro de la especie, basándose en la alineación múltiple antes mencionada, utilizando DnaSP versión 5.10.01 [58]. La relación entre el número de sitios polimórficos y el número mínimo de señales visibles de ADNr 5S se investigó mediante análisis de regresión lineal (en Microsoft Excel).

La reconstrucción filogenética se realizó utilizando la optimización de máxima verosimilitud disponible a través del servidor web RaxML BlackBox [59] que ejecuta RaxML versión 7.2.8 [60]. Se utilizaron los ajustes predeterminados. El 8 Phragmipedium besseae las secuencias se indicaron como el grupo externo. RaxML se llamó usando los siguientes comandos: raxml - # 100 -n pegado -o bess1, bess2, bess3, bess4, bess5, bess6, bess7, bess8 -f a -m GTRGAMMA -x 564547904 -p 564547904 -s 0VaDTW. Toda la información de búsqueda, tal como se publicó en el sitio web, se incluye en el archivo adicional 5.


Caracterización de las secuencias completas de ADN ribosómico nuclear de Eurytrema pancreaticum

Eurytrema pancreaticum es uno de los trematodos más comunes del ganado bovino y ovino, y también ocasionalmente infecta al ser humano, provocando grandes pérdidas económicas y costos médicos. En este estudio, se determinaron por primera vez las secuencias de las unidades repetidas de ADN ribosómico nuclear completo (ADNr) de cinco individuos de E. pancreaticum. Tenían entre 8306 y 8310 pb de longitud, incluido el rDNA de subunidad pequeña (18S), el espaciador transcrito interno 1 (ITS1), el rDNA 5.8S, el espaciador transcrito interno 2 (ITS2), el rDNA de subunidad grande (28S) y el espaciador intergénico (IGS) . No hubo variaciones de longitud en ninguna de las secuencias de rDNA de 18S (1996 pb), ITS1 (1103 pb), 5,8S (160 pb), ITS2 (231 pb) o 28S (3669 pb) investigadas, mientras que las secuencias de rDNA de IGS de E . pancreaticum tenía una variación de longitud de 4 pb, que variaba de 1147 a 1151 pb. Las variaciones intraespecíficas dentro de E. pancreaticum fueron del 0 al 0,2% para el ADNr 18S, del 0 al 0,5% para ITS1, del 0% para el ADNr 5.8S e ITS2, del 0 al 0,2% para el ADNr 28S y del 2,9 al 20,2% para IGS. Había nueve tipos de secuencias repetidas en ITS1, dos tipos en rDNA 28S, pero ninguno en IGS. Un análisis filogenético basado en las secuencias de ADNr 18S clasificó a E. pancreaticum en la familia Dicrocoeliidae de Plagiorchiata, estrechamente relacionada con el suborden Opisthorchiata. These results provide useful information for the further study of Dicrocoeliidae trematodes.


Restriction Digestion


Restriction enzymes are endonucleases which cleave double-stranded DNA at specific oligonucleotide sequences. The specific sites at which they cleave the nucleic acids in order to generate a set of smaller fragments are called restriction sites. The natural function of restriction enzymes in bacteria may be the destruction of foreign DNA that may enter the bacterial cell. But the cells own DNA is not cleaved by these restriction enzymes. This self protection is achieved by the help of the specific DNA methyltransferase enzyme which will methylates the specific DNA sequence for its respective restriction enzymes by transferring methyl groups to adenine or cytosine residues to produce N6-methyladenine or 5-methylcytosine. An interesting feature of restriction endonuclease is that they commonly recognize recognition sequences that are mostly palindromes - they shows the same forward (5' to 3' on the top strand) and backward (5' to 3' on the bottom strand) sequences. The DNA fragments of varying length can be separated by gel electrophoresis and stained with ethidium bromide and can be photographed for future studies.


Corneo, G., Ginelli, E., and Polli, E., J. Mol. Biol., 33, 331 (1968).

Corneo, G., Ginelli, E., and Polli, E., J. Mol. Biol., 48, 319 (1970).

Coudray, Y., Quetier, F., and Guille, E., Biochim. Biophys. Acta, 217, 259 (1970).

Birnstiel, M., Wallace, H., Sirlin, J. L., and Fischberg, M., Nat. Cancer Inst. Monog., 23, 431 (1966).

Birnstiel, M., and Keddes, L. H., Nature New Biology, 230, 165 (1971).

John, H. A., Birnstiel, M., and Jones, K. W., Naturaleza, 223, 582 (1969).

Pardue, M. L., and Gall, J., Proc. US Nat. Acad. Sci., 64, 600 (1969).

Chamberlain, M., and Berg, P., Proc. US Nat. Acad. Sci., 48, 81 (1961).

MacGreggor, H. C., and Kezer, J., Cromosoma, 33, 167 (1971).

Court Brown, W. M., Buckton, K. E., Jacobs, P. A., Tough, I. M., Kunsberg, E. V., and Knox, J. D. E., Eugenics Lab. Memoirs, 42 (Cambridge University Press, 1966).

Sumner, A. T., Evans, H. J., and Buckland, R. A., Nature New Biology, 232, 31 (1971).

Jones, K. W., Naturaleza, 225, 912 (1970).

Pardue, M. L., and Gall, J. G., Ciencias, 168, 1556 (1970).

Hennig, W., and Walker, P. M. B., Naturaleza, 225, 915 (1970).

Jones, K. W., and Robertson, F. W., Cromosoma, 31, 331 (1970).

Arrighi, F., Hsu, T. C., Saunders, P., and Saunders, G. F., Cromosoma, 32, 224 (1971).


Ver el vídeo: Introducción a la secuenciación de ADN parte 1 (Enero 2022).